ID: 1049880428

View in Genome Browser
Species Human (GRCh38)
Location 8:145058327-145058349
Sequence CCTGCTAAGCAGGTCTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049880428_1049880431 -4 Left 1049880428 8:145058327-145058349 CCATGAAAGACCTGCTTAGCAGG No data
Right 1049880431 8:145058346-145058368 CAGGTAATCTCTTCTCATCCTGG No data
1049880428_1049880432 4 Left 1049880428 8:145058327-145058349 CCATGAAAGACCTGCTTAGCAGG No data
Right 1049880432 8:145058354-145058376 CTCTTCTCATCCTGGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049880428 Original CRISPR CCTGCTAAGCAGGTCTTTCA TGG (reversed) Intergenic
No off target data available for this crispr