ID: 1049884475

View in Genome Browser
Species Human (GRCh38)
Location 9:18058-18080
Sequence CTTGCTCTGGATCCTGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049884469_1049884475 -1 Left 1049884469 9:18036-18058 CCCGCTCGTCCAGGGGGCGGTGC No data
Right 1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG No data
1049884462_1049884475 16 Left 1049884462 9:18019-18041 CCAGCAGACCTGCAGGGCCCGCT No data
Right 1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG No data
1049884470_1049884475 -2 Left 1049884470 9:18037-18059 CCGCTCGTCCAGGGGGCGGTGCT No data
Right 1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG No data
1049884471_1049884475 -10 Left 1049884471 9:18045-18067 CCAGGGGGCGGTGCTTGCTCTGG No data
Right 1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG No data
1049884463_1049884475 8 Left 1049884463 9:18027-18049 CCTGCAGGGCCCGCTCGTCCAGG No data
Right 1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049884475 Original CRISPR CTTGCTCTGGATCCTGTGGC GGG Intergenic
No off target data available for this crispr