ID: 1049885146

View in Genome Browser
Species Human (GRCh38)
Location 9:21719-21741
Sequence TTGTGTCCCCACGGTGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049885146_1049885156 22 Left 1049885146 9:21719-21741 CCCGTGGCACCGTGGGGACACAA No data
Right 1049885156 9:21764-21786 CAGCCCCATTCAAAGAGGCCTGG No data
1049885146_1049885160 30 Left 1049885146 9:21719-21741 CCCGTGGCACCGTGGGGACACAA No data
Right 1049885160 9:21772-21794 TTCAAAGAGGCCTGGCCCACAGG No data
1049885146_1049885153 17 Left 1049885146 9:21719-21741 CCCGTGGCACCGTGGGGACACAA No data
Right 1049885153 9:21759-21781 TCCCTCAGCCCCATTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049885146 Original CRISPR TTGTGTCCCCACGGTGCCAC GGG (reversed) Intergenic
No off target data available for this crispr