ID: 1049886633

View in Genome Browser
Species Human (GRCh38)
Location 9:31571-31593
Sequence GTGTATATTCACAGGCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049886633_1049886635 4 Left 1049886633 9:31571-31593 CCACGATGCCTGTGAATATACAC No data
Right 1049886635 9:31598-31620 ACCACATCATATACCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049886633 Original CRISPR GTGTATATTCACAGGCATCG TGG (reversed) Intergenic
No off target data available for this crispr