ID: 1049886674

View in Genome Browser
Species Human (GRCh38)
Location 9:31859-31881
Sequence CCCAGCTGGCCAGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049886674_1049886680 -9 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886680 9:31873-31895 CCAGCTGGGCTGAGCGGGCCTGG No data
1049886674_1049886682 0 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886682 9:31882-31904 CTGAGCGGGCCTGGGAATTAAGG No data
1049886674_1049886686 12 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886686 9:31894-31916 GGGAATTAAGGCTGCAGGGTTGG No data
1049886674_1049886684 8 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886684 9:31890-31912 GCCTGGGAATTAAGGCTGCAGGG No data
1049886674_1049886683 7 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886683 9:31889-31911 GGCCTGGGAATTAAGGCTGCAGG No data
1049886674_1049886687 19 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG No data
1049886674_1049886681 -8 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886681 9:31874-31896 CAGCTGGGCTGAGCGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049886674 Original CRISPR CCCAGCTGGCCAGCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr