ID: 1049886687

View in Genome Browser
Species Human (GRCh38)
Location 9:31901-31923
Sequence AAGGCTGCAGGGTTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049886674_1049886687 19 Left 1049886674 9:31859-31881 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG No data
1049886676_1049886687 15 Left 1049886676 9:31863-31885 CCTTTGCTGGCCAGCTGGGCTGA No data
Right 1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG No data
1049886679_1049886687 5 Left 1049886679 9:31873-31895 CCAGCTGGGCTGAGCGGGCCTGG No data
Right 1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049886687 Original CRISPR AAGGCTGCAGGGTTGGTCCC AGG Intergenic
No off target data available for this crispr