ID: 1049890326

View in Genome Browser
Species Human (GRCh38)
Location 9:63236-63258
Sequence GGGTGGGCATGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049890311_1049890326 24 Left 1049890311 9:63189-63211 CCTCATGCAATGAGCAGATTAAG No data
Right 1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049890326 Original CRISPR GGGTGGGCATGGAGGGGAGA GGG Intergenic
No off target data available for this crispr