ID: 1049890471

View in Genome Browser
Species Human (GRCh38)
Location 9:65377-65399
Sequence GTCTAACAGAAGGGTATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049890467_1049890471 27 Left 1049890467 9:65327-65349 CCAAATAATCTTGTTTAAATGTT No data
Right 1049890471 9:65377-65399 GTCTAACAGAAGGGTATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049890471 Original CRISPR GTCTAACAGAAGGGTATCCA GGG Intergenic
No off target data available for this crispr