ID: 1049891425

View in Genome Browser
Species Human (GRCh38)
Location 9:73622-73644
Sequence CGGTCTGGCAGCGGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049891425_1049891434 9 Left 1049891425 9:73622-73644 CCACCTTCTCCGCTGCCAGACCG No data
Right 1049891434 9:73654-73676 CCCTCAGTTTCTCCCCAAGTGGG No data
1049891425_1049891432 8 Left 1049891425 9:73622-73644 CCACCTTCTCCGCTGCCAGACCG No data
Right 1049891432 9:73653-73675 GCCCTCAGTTTCTCCCCAAGTGG No data
1049891425_1049891437 21 Left 1049891425 9:73622-73644 CCACCTTCTCCGCTGCCAGACCG No data
Right 1049891437 9:73666-73688 CCCCAAGTGGGACTCACTGTCGG No data
1049891425_1049891441 23 Left 1049891425 9:73622-73644 CCACCTTCTCCGCTGCCAGACCG No data
Right 1049891441 9:73668-73690 CCAAGTGGGACTCACTGTCGGGG No data
1049891425_1049891439 22 Left 1049891425 9:73622-73644 CCACCTTCTCCGCTGCCAGACCG No data
Right 1049891439 9:73667-73689 CCCAAGTGGGACTCACTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049891425 Original CRISPR CGGTCTGGCAGCGGAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr