ID: 1049891694

View in Genome Browser
Species Human (GRCh38)
Location 9:75603-75625
Sequence GCGTGGTGGCATGTACCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049891694_1049891702 30 Left 1049891694 9:75603-75625 CCTACAGGTACATGCCACCACGC No data
Right 1049891702 9:75656-75678 GGGGTTTCACCATGTTGCCTAGG 0: 363
1: 8816
2: 91778
3: 182747
4: 226663
1049891694_1049891700 10 Left 1049891694 9:75603-75625 CCTACAGGTACATGCCACCACGC No data
Right 1049891700 9:75636-75658 TTTGTAGTTTTTGTAGACATGGG 0: 6
1: 278
2: 8676
3: 119036
4: 271590
1049891694_1049891699 9 Left 1049891694 9:75603-75625 CCTACAGGTACATGCCACCACGC No data
Right 1049891699 9:75635-75657 TTTTGTAGTTTTTGTAGACATGG 0: 7
1: 450
2: 14183
3: 231904
4: 143756
1049891694_1049891701 11 Left 1049891694 9:75603-75625 CCTACAGGTACATGCCACCACGC No data
Right 1049891701 9:75637-75659 TTGTAGTTTTTGTAGACATGGGG 0: 6
1: 268
2: 7871
3: 107908
4: 196727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049891694 Original CRISPR GCGTGGTGGCATGTACCTGT AGG (reversed) Intergenic
No off target data available for this crispr