ID: 1049892170

View in Genome Browser
Species Human (GRCh38)
Location 9:80296-80318
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049892170_1049892172 -1 Left 1049892170 9:80296-80318 CCATCAGAGTTTACCAATCTTTT No data
Right 1049892172 9:80318-80340 TGTTCATTCCCTCAGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049892170 Original CRISPR AAAAGATTGGTAAACTCTGA TGG (reversed) Intergenic
No off target data available for this crispr