ID: 1049894914

View in Genome Browser
Species Human (GRCh38)
Location 9:104145-104167
Sequence GCACGCACTCCCCGCATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049894914_1049894916 -2 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894914_1049894927 17 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894914_1049894924 14 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894924 9:104182-104204 TCCCTGGTTTTTAGGATCCGCGG No data
1049894914_1049894921 6 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894921 9:104174-104196 CTCTTCCCTCCCTGGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049894914 Original CRISPR GCACGCACTCCCCGCATCAA GGG (reversed) Intergenic