ID: 1049894916

View in Genome Browser
Species Human (GRCh38)
Location 9:104166-104188
Sequence GCCAGCCCCTCTTCCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049894906_1049894916 23 Left 1049894906 9:104120-104142 CCCATCGCAAGGGGGTGAGACAC No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894914_1049894916 -2 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894913_1049894916 -1 Left 1049894913 9:104144-104166 CCCCTTGATGCGGGGAGTGCGTG No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894912_1049894916 0 Left 1049894912 9:104143-104165 CCCCCTTGATGCGGGGAGTGCGT No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894915_1049894916 -3 Left 1049894915 9:104146-104168 CCTTGATGCGGGGAGTGCGTGCC No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894907_1049894916 22 Left 1049894907 9:104121-104143 CCATCGCAAGGGGGTGAGACACC No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894904_1049894916 25 Left 1049894904 9:104118-104140 CCCCCATCGCAAGGGGGTGAGAC No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894905_1049894916 24 Left 1049894905 9:104119-104141 CCCCATCGCAAGGGGGTGAGACA No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data
1049894911_1049894916 1 Left 1049894911 9:104142-104164 CCCCCCTTGATGCGGGGAGTGCG No data
Right 1049894916 9:104166-104188 GCCAGCCCCTCTTCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049894916 Original CRISPR GCCAGCCCCTCTTCCCTCCC TGG Intergenic