ID: 1049894921

View in Genome Browser
Species Human (GRCh38)
Location 9:104174-104196
Sequence CTCTTCCCTCCCTGGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049894907_1049894921 30 Left 1049894907 9:104121-104143 CCATCGCAAGGGGGTGAGACACC No data
Right 1049894921 9:104174-104196 CTCTTCCCTCCCTGGTTTTTAGG No data
1049894911_1049894921 9 Left 1049894911 9:104142-104164 CCCCCCTTGATGCGGGGAGTGCG No data
Right 1049894921 9:104174-104196 CTCTTCCCTCCCTGGTTTTTAGG No data
1049894915_1049894921 5 Left 1049894915 9:104146-104168 CCTTGATGCGGGGAGTGCGTGCC No data
Right 1049894921 9:104174-104196 CTCTTCCCTCCCTGGTTTTTAGG No data
1049894914_1049894921 6 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894921 9:104174-104196 CTCTTCCCTCCCTGGTTTTTAGG No data
1049894912_1049894921 8 Left 1049894912 9:104143-104165 CCCCCTTGATGCGGGGAGTGCGT No data
Right 1049894921 9:104174-104196 CTCTTCCCTCCCTGGTTTTTAGG No data
1049894913_1049894921 7 Left 1049894913 9:104144-104166 CCCCTTGATGCGGGGAGTGCGTG No data
Right 1049894921 9:104174-104196 CTCTTCCCTCCCTGGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049894921 Original CRISPR CTCTTCCCTCCCTGGTTTTT AGG Intergenic