ID: 1049894924

View in Genome Browser
Species Human (GRCh38)
Location 9:104182-104204
Sequence TCCCTGGTTTTTAGGATCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049894914_1049894924 14 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894924 9:104182-104204 TCCCTGGTTTTTAGGATCCGCGG No data
1049894911_1049894924 17 Left 1049894911 9:104142-104164 CCCCCCTTGATGCGGGGAGTGCG No data
Right 1049894924 9:104182-104204 TCCCTGGTTTTTAGGATCCGCGG No data
1049894913_1049894924 15 Left 1049894913 9:104144-104166 CCCCTTGATGCGGGGAGTGCGTG No data
Right 1049894924 9:104182-104204 TCCCTGGTTTTTAGGATCCGCGG No data
1049894915_1049894924 13 Left 1049894915 9:104146-104168 CCTTGATGCGGGGAGTGCGTGCC No data
Right 1049894924 9:104182-104204 TCCCTGGTTTTTAGGATCCGCGG No data
1049894912_1049894924 16 Left 1049894912 9:104143-104165 CCCCCTTGATGCGGGGAGTGCGT No data
Right 1049894924 9:104182-104204 TCCCTGGTTTTTAGGATCCGCGG No data
1049894917_1049894924 -8 Left 1049894917 9:104167-104189 CCAGCCCCTCTTCCCTCCCTGGT No data
Right 1049894924 9:104182-104204 TCCCTGGTTTTTAGGATCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049894924 Original CRISPR TCCCTGGTTTTTAGGATCCG CGG Intergenic