ID: 1049894927

View in Genome Browser
Species Human (GRCh38)
Location 9:104185-104207
Sequence CTGGTTTTTAGGATCCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049894918_1049894927 -9 Left 1049894918 9:104171-104193 CCCCTCTTCCCTCCCTGGTTTTT No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894914_1049894927 17 Left 1049894914 9:104145-104167 CCCTTGATGCGGGGAGTGCGTGC No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894912_1049894927 19 Left 1049894912 9:104143-104165 CCCCCTTGATGCGGGGAGTGCGT No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894911_1049894927 20 Left 1049894911 9:104142-104164 CCCCCCTTGATGCGGGGAGTGCG No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894913_1049894927 18 Left 1049894913 9:104144-104166 CCCCTTGATGCGGGGAGTGCGTG No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894915_1049894927 16 Left 1049894915 9:104146-104168 CCTTGATGCGGGGAGTGCGTGCC No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894917_1049894927 -5 Left 1049894917 9:104167-104189 CCAGCCCCTCTTCCCTCCCTGGT No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data
1049894919_1049894927 -10 Left 1049894919 9:104172-104194 CCCTCTTCCCTCCCTGGTTTTTA No data
Right 1049894927 9:104185-104207 CTGGTTTTTAGGATCCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049894927 Original CRISPR CTGGTTTTTAGGATCCGCGG TGG Intergenic