ID: 1049899895

View in Genome Browser
Species Human (GRCh38)
Location 9:149428-149450
Sequence AGGCTTTTACAGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 6, 2: 0, 3: 15, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049899895_1049899900 18 Left 1049899895 9:149428-149450 CCCTACTCCATCTGTAAAAGCCT 0: 1
1: 6
2: 0
3: 15
4: 182
Right 1049899900 9:149469-149491 CAGGTCAATGACTGTCTTCTCGG No data
1049899895_1049899899 -1 Left 1049899895 9:149428-149450 CCCTACTCCATCTGTAAAAGCCT 0: 1
1: 6
2: 0
3: 15
4: 182
Right 1049899899 9:149450-149472 TTATTCATTCTTTAAGACTCAGG 0: 7
1: 0
2: 4
3: 44
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049899895 Original CRISPR AGGCTTTTACAGATGGAGTA GGG (reversed) Intronic
900910255 1:5592334-5592356 TGACTTTTGAAGATGGAGTAAGG + Intergenic
901892540 1:12279842-12279864 AGCCTTTTTCATATGGAGGAGGG + Intronic
903483734 1:23674141-23674163 AGGCTTTGACAGGTGGGGGAAGG - Intergenic
903811959 1:26039536-26039558 AGGCTTTTACAGCTAGTATATGG - Intronic
905339657 1:37269794-37269816 AGGCTTTATCAGTAGGAGTATGG + Intergenic
905486503 1:38301078-38301100 GGGCTTCTATAGATGGAGAAGGG + Intergenic
906875176 1:49529778-49529800 AGGCAGTTACAAATGGGGTATGG + Intronic
907185686 1:52607452-52607474 AGGCTTCTGCAGCTGGAGAAGGG - Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
910951931 1:92657814-92657836 AGGCTTTTACTCATTGAGGAAGG + Intronic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
912308457 1:108595353-108595375 TGGCTTTTACAGAGGGAGAGAGG + Intronic
913070095 1:115290691-115290713 AGGCTTTAAGAGATAGAGAAGGG - Intronic
916091270 1:161309566-161309588 TGAATTTTACAGATGGAGTCTGG + Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
917829731 1:178867965-178867987 AGGCAAATATAGATGGAGTATGG + Intronic
919199479 1:194336410-194336432 AAGCTTTTACTGATGGTGCAAGG + Intergenic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
923165298 1:231355841-231355863 AGTGTTTAACAGATGTAGTAAGG - Intergenic
1066549422 10:36539152-36539174 AGGCTTTTCCACATGGAGGCTGG - Intergenic
1068357447 10:55928129-55928151 AGGCTTTTATAAATGGAATCGGG - Intergenic
1068610762 10:59057480-59057502 ATGCTTTTTCAGATGGAGATTGG + Intergenic
1073093074 10:100960603-100960625 AGGCTTTTTGAAATGAAGTATGG - Intronic
1073982982 10:109175953-109175975 AAGCTTTTACTCATGGAGGAAGG - Intergenic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1079507040 11:21164650-21164672 TGGCTTTTAAAAATAGAGTAAGG + Intronic
1079572615 11:21963283-21963305 GAGCTTTTAAAGATGGAATATGG - Intergenic
1080302073 11:30795761-30795783 AGGATTATAGAGATGCAGTATGG - Intergenic
1080883529 11:36345010-36345032 AGGCTTTTCCAGATGGCAAAGGG + Intronic
1082631355 11:55545915-55545937 AAGATTGTAAAGATGGAGTAAGG - Intergenic
1082862198 11:57867476-57867498 AGGCTTTTACTCATGGTGGAAGG + Intergenic
1082862548 11:57869789-57869811 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1082955531 11:58866164-58866186 AAGCTTTTACAGAGGAAGAAAGG - Intronic
1086036813 11:82425603-82425625 AGGCCTTTAGAGATGTGGTAAGG - Intergenic
1086889363 11:92238551-92238573 GGGCTGTTACAGATGGGGAAAGG + Intergenic
1088549410 11:110996121-110996143 AGACTTTTAAAGATTGAGTGGGG + Intergenic
1089136709 11:116255034-116255056 AGGCCTTTAGAGATGTAATAAGG - Intergenic
1089575759 11:119441928-119441950 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1093774747 12:23060328-23060350 AGGCTTTTATAGAGTCAGTATGG - Intergenic
1094408101 12:30140197-30140219 AAGCTTTTACTCATGGAATAAGG - Intergenic
1095863572 12:46947180-46947202 AGACATTTACAGTTGGAGGAAGG - Intergenic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1101918320 12:108912925-108912947 AAGCTTTTACTCATGGAGGAAGG - Intronic
1103887068 12:124210498-124210520 AGGCATTTACAGATGTAATTAGG - Intronic
1105711068 13:23009537-23009559 AAGCTGTTACAGATGGTGGAAGG + Intergenic
1106932463 13:34681797-34681819 AGGCTGTTACAAAAGGAGAAGGG - Intergenic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1108461930 13:50675604-50675626 AGGCTTGGAAGGATGGAGTAGGG - Intronic
1109848406 13:68028359-68028381 AGGCTTTTAAAGAAAGAATAAGG - Intergenic
1110877790 13:80531820-80531842 TGGCATTTACAAAAGGAGTAAGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1112243032 13:97701393-97701415 AGGTTTCTTCAGATTGAGTAAGG - Intergenic
1114539964 14:23447779-23447801 AGGCTTTTACAGGAGGAACATGG + Intergenic
1115322035 14:32092392-32092414 AGTCTTTTACAGTTGGATCATGG + Exonic
1116625934 14:47263321-47263343 AGGCTTTTGGGGATGGAGGATGG - Intronic
1119857943 14:77914936-77914958 TGGCTTTTACAGTGGGGGTAAGG - Intronic
1120655255 14:87181510-87181532 AAGCTTTGAAAGATGGAGCACGG - Intergenic
1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG + Exonic
1120953636 14:90062913-90062935 AGGCTTTTACAGATAGGGACAGG + Intronic
1126654731 15:50965048-50965070 AAGCTTTTACTTATGGAGGAAGG - Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128360363 15:66957446-66957468 AGGCTATTTCACCTGGAGTAGGG + Intergenic
1129801595 15:78418977-78418999 TGGCTGTTACAGATAGAGTCAGG + Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1133319695 16:4905281-4905303 AGGCTTGTTCAGATGGAGCACGG - Intronic
1139557923 16:67724407-67724429 AGGCTTTTGCAGCTGGAATGGGG - Exonic
1141291408 16:82721423-82721445 AGGCAGTTAAAGAGGGAGTAGGG + Intronic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1145099025 17:20058286-20058308 AGGCTTTTCAACATGCAGTATGG - Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1150004055 17:61458671-61458693 GTTCTTTTACAGATGGAGTGGGG - Intronic
1150457609 17:65320129-65320151 AGGCTTCAACATATGAAGTATGG + Intergenic
1150589435 17:66549223-66549245 AGGCTTAGAGAGATGGATTAAGG + Intronic
1150770503 17:68036692-68036714 AAGATTTCAAAGATGGAGTATGG + Intronic
1156117230 18:33800400-33800422 GGGCTTTTTCTGAAGGAGTAGGG - Intergenic
1156579632 18:38359858-38359880 AGGCTGTGTCAGATGGAGTAAGG - Intergenic
1158445049 18:57512188-57512210 AGGCTTTTGAAAATGGAATAAGG - Intergenic
1158617154 18:58998654-58998676 AGGCTCCTACAGATGGAACAAGG - Intergenic
1158904115 18:61995097-61995119 AGGCTCTCAAAGATGTAGTAAGG - Intergenic
1159755870 18:72363818-72363840 AGGCGTTTACAGCTGGAGACTGG - Intergenic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1166057846 19:40303895-40303917 AAGCATTTTCAGTTGGAGTAGGG - Intergenic
1167034213 19:46984203-46984225 AGGCTTTCTCAGATGGACTTGGG + Intronic
925121909 2:1425494-1425516 ATGACTTTACAGAAGGAGTACGG - Intronic
925124193 2:1442209-1442231 AGACTAATACAGATGGAGTAGGG + Intronic
928172403 2:29012091-29012113 AGGCCTTTAAAGAGGGAGGAGGG + Intronic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
932118615 2:69077556-69077578 AGGCTTTGAGAGATGGAATTGGG - Intronic
933225065 2:79738496-79738518 AGGCTTTTCCTGTTGGAGGAGGG + Intronic
933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG + Intergenic
933639738 2:84746835-84746857 AAGCTTTTACATATGGTGAAAGG + Intronic
935745089 2:106183421-106183443 AGTCTTTTTCAGAGGGAGTCTGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936813104 2:116426284-116426306 GGGCTTTTTCAGATGAAGTCTGG - Intergenic
938640885 2:133278392-133278414 TGGCTTTTGAAGATGGAGGAAGG - Intronic
938908186 2:135859235-135859257 AGGCCTTTACTGATAGGGTAGGG + Intronic
940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG + Intronic
942883524 2:180893479-180893501 AAGCTTTTACTCATGGTGTAAGG - Intergenic
944644135 2:201761521-201761543 AGGATTTTACAGTTGGCGTGTGG - Exonic
1171171962 20:23023447-23023469 AGGCTGAGAAAGATGGAGTAGGG - Intergenic
1175304026 20:57963787-57963809 AGGATTTTACATATGGCTTAGGG - Intergenic
1179163566 21:38917577-38917599 TGGCTTCTACAGAGGGAGAAGGG + Intergenic
1181016487 22:20072217-20072239 AAGCATCTTCAGATGGAGTAGGG + Intergenic
949560525 3:5197704-5197726 AGGCTTTAACAGATGTGCTAGGG + Intronic
949796093 3:7852638-7852660 AGACTTTTACAGAGGTAGAAAGG - Intergenic
952685616 3:36144627-36144649 AGGAATTCACAGTTGGAGTATGG - Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953949258 3:47175750-47175772 AGGCTTTTACTCATGGTGAAAGG - Intergenic
954042326 3:47898170-47898192 ACGCTTTTACAGAGGGGGAAGGG + Intronic
954718271 3:52538051-52538073 AGGCTTTAACATGTGGAGAATGG + Intronic
955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG + Intergenic
956756342 3:72391517-72391539 TGGGTTTTACAGAAGAAGTATGG - Intronic
957019987 3:75115594-75115616 AGACTTTGATAGATGGAATAGGG + Intergenic
959219165 3:103493846-103493868 ACCCTTTTACAGATGGAGAGTGG - Intergenic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
964724702 3:159802667-159802689 AGCCACTTACAAATGGAGTATGG - Intronic
965439050 3:168690865-168690887 TGGCTTTTGCAGTTGGAGGAGGG + Intergenic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
967736617 3:192959766-192959788 AGACTAATACAGATGGAGTAGGG - Intergenic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
972273513 4:37535446-37535468 GGCCATTTACAGATGGAGTGGGG + Intronic
978918482 4:114152797-114152819 CTGCTTCTACAGATGAAGTAAGG - Intergenic
979037307 4:115738374-115738396 AAGCTTTAAAAGATGTAGTAAGG - Intergenic
979107865 4:116710474-116710496 AGCCTTTTGCAGATGTAATAGGG + Intergenic
979466312 4:121042388-121042410 ATGCTTTTGGAGATGGAGAATGG + Intronic
982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG + Intergenic
982840540 4:160179355-160179377 GAGCTTTTGCACATGGAGTATGG - Intergenic
985206131 4:187538993-187539015 AGACTTTTACTGATGGTCTAAGG - Intergenic
986516971 5:8574534-8574556 AAGCTTTTACTCATGGAGAAAGG + Intergenic
987640607 5:20607025-20607047 TGGCTTTCAAAGATGGAGGAAGG + Intergenic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
989217922 5:38924191-38924213 TGCCTTTTACAGATGAAGAATGG - Intronic
990914006 5:60882907-60882929 AGGCTTCTAGAGACAGAGTAGGG - Intronic
992040940 5:72831273-72831295 TGGCTTTTACATATTTAGTAGGG + Intronic
992895926 5:81245174-81245196 AGGCTTTGACAGCTGGGGCAGGG + Intronic
993772144 5:91941970-91941992 AGACTTTAACAGCTAGAGTAGGG - Intergenic
997202259 5:132018084-132018106 AGGCTTTTAGAGGTGGTGGAAGG + Intergenic
997553058 5:134770502-134770524 ATACTTTTACAGGTGGGGTAAGG - Intronic
998515431 5:142749554-142749576 AAGCTTTTACTCATGGAGGAAGG - Intergenic
998901512 5:146860519-146860541 AGGCTGTTAAAGACAGAGTATGG - Intronic
999473207 5:151874584-151874606 TGGCTTTTTCAGCTGGAGTGGGG - Intronic
1000779277 5:165460126-165460148 AGGCTCTGACAGATGGGATAAGG + Intergenic
1001012133 5:168108062-168108084 AGGCTTATAAAGATGAAATATGG + Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1006931207 6:37689595-37689617 GGGCTTTTACAGCTGGTGTGGGG + Intronic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1009163610 6:60312694-60312716 GAGCTTTTACCGATGGAGGAAGG - Intergenic
1009525398 6:64738371-64738393 AAGCTTTTACTTATGGAGCAAGG - Intronic
1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG + Intronic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1012581549 6:100876061-100876083 AGACTGTGACTGATGGAGTAGGG + Intronic
1017707540 6:157137713-157137735 AGGCTATTACAGAGTGAGTGAGG - Intronic
1018363192 6:163093546-163093568 AAGCTTTTACAGCTGGAATATGG + Intronic
1021083674 7:16393558-16393580 TGGAGTTTACAGATTGAGTAGGG - Intronic
1022743806 7:33149164-33149186 AGGCTTTCATTGATGGAGCAGGG + Intronic
1024957210 7:54935415-54935437 AGTCTTTTACAGTTGGATCACGG + Intergenic
1025224898 7:57149676-57149698 AGGCATTCACAGCTGGAGTGTGG - Intergenic
1025242155 7:57286063-57286085 AGGCTTTCACTCATGGGGTAAGG + Intergenic
1028251699 7:88545533-88545555 AGGCTTTTACATATTTATTAGGG + Intergenic
1028345730 7:89779858-89779880 AGGCTTTTTCAGCTGGAGGGTGG - Intergenic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1030276704 7:107728717-107728739 GGGCTTTAACAGGTGGAGTTGGG + Intergenic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032998878 7:137480914-137480936 AGGCATTTATAGATGTAGTAGGG - Intronic
1033656602 7:143379752-143379774 TGACGTTTACAGATGGAGCAGGG + Intergenic
1034738349 7:153450224-153450246 AGGCTTGTGCAGAGGGAGAAAGG + Intergenic
1035161198 7:156951021-156951043 AGGCCTTAACAGATGAGGTAGGG - Intronic
1036044707 8:5126877-5126899 AGTCCTTTACAGATGGAGTCAGG + Intergenic
1037645365 8:20787888-20787910 AGGCATTTAAAGATGGGGAAGGG + Intergenic
1038010383 8:23471245-23471267 GGGATTTTACAGATTGATTAAGG - Intergenic
1039121019 8:34146464-34146486 AGCCCTTTACAGGTGGGGTAGGG - Intergenic
1039273004 8:35903474-35903496 AGGCTTTTACTCATGGTGGAAGG - Intergenic
1040816217 8:51511092-51511114 AGGCTTTTACAGGGGCAGGATGG + Intronic
1041471046 8:58209259-58209281 AGTCTTTTACTGATGGTTTATGG + Intergenic
1044190715 8:89313559-89313581 TGGCTTTTACATATAGAGTAAGG + Intergenic
1044850817 8:96425481-96425503 TGGCTTCTACACATGGAGGAAGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050352318 9:4752134-4752156 GGGCTTCTAAAGATGGAGAAGGG + Intergenic
1052698205 9:31906044-31906066 AAGCTTTTACTCATGGAGGAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055618611 9:78099614-78099636 AGGCTTTAACATATGGATTTTGG - Intergenic
1059340404 9:113594652-113594674 AGGCTTTCACAGAGGGAGCTGGG + Intronic
1060333406 9:122697649-122697671 TGGCTGTTCCAGCTGGAGTAAGG - Intergenic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1185745552 X:2569869-2569891 AAGCTTTTACTCATGGAGGAAGG + Intergenic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1190484778 X:50913499-50913521 AGGCTTGTACAGATGATGTGAGG + Intronic
1192323195 X:70108875-70108897 AAGCATTTTCAGTTGGAGTAGGG + Intergenic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1193460291 X:81783271-81783293 AGGCTTTTAAAGCTGGGGTTTGG + Intergenic
1195349959 X:103986373-103986395 TGGCTTTGACACATGGAGAATGG - Intergenic
1195351960 X:104004770-104004792 TGGCTTTGACACATGGAGAATGG + Intergenic
1195357484 X:104052466-104052488 TGGCTTTGACACATGGAGAATGG + Intergenic
1195509411 X:105696986-105697008 AAGCTTTTACTCATGGAGGAAGG + Intronic
1196055455 X:111350369-111350391 AGGCTTTTACAAATGCAAAATGG - Intronic
1197303765 X:124814723-124814745 AGACCTTTACTGATAGAGTAGGG + Intronic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic