ID: 1049901676

View in Genome Browser
Species Human (GRCh38)
Location 9:173839-173861
Sequence ACCTTCCTCAAGATGAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 2, 2: 2, 3: 7, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049901676_1049901682 24 Left 1049901676 9:173839-173861 CCCTAGTTCATCTTGAGGAAGGT 0: 2
1: 2
2: 2
3: 7
4: 94
Right 1049901682 9:173886-173908 ATTTAAAAATTAAACTTATAGGG 0: 3
1: 2
2: 16
3: 175
4: 1611
1049901676_1049901683 27 Left 1049901676 9:173839-173861 CCCTAGTTCATCTTGAGGAAGGT 0: 2
1: 2
2: 2
3: 7
4: 94
Right 1049901683 9:173889-173911 TAAAAATTAAACTTATAGGGAGG 0: 3
1: 2
2: 2
3: 55
4: 515
1049901676_1049901681 23 Left 1049901676 9:173839-173861 CCCTAGTTCATCTTGAGGAAGGT 0: 2
1: 2
2: 2
3: 7
4: 94
Right 1049901681 9:173885-173907 CATTTAAAAATTAAACTTATAGG 0: 3
1: 5
2: 11
3: 113
4: 1093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049901676 Original CRISPR ACCTTCCTCAAGATGAACTA GGG (reversed) Intronic
901300194 1:8194692-8194714 ACCTTACTCAAGATGACATAAGG + Intergenic
903004022 1:20286609-20286631 ACCCTGCTCAAGATGTTCTAGGG + Intergenic
905227063 1:36485941-36485963 ACCTTAGTCAAGCTGAATTAGGG + Intergenic
909674094 1:78219857-78219879 TCTTACCTCAAGATGAATTAAGG + Intergenic
910394111 1:86774616-86774638 ATCTTACTCAAGATGAAGTAAGG - Intergenic
914997568 1:152558412-152558434 ACCCTCTTCAGGATGAACTCAGG + Intronic
917072053 1:171162389-171162411 AACTTCCTCAACATGAAAAAGGG + Intergenic
918473816 1:184902539-184902561 AAAGTCCTCAAGCTGAACTAAGG + Intronic
919276622 1:195426142-195426164 AGCTTGCTTAAGATGTACTAAGG + Intergenic
920456228 1:206103601-206103623 TTCTTCCCCAAGATGATCTAAGG + Intergenic
1066194727 10:33088154-33088176 GGCCTCCTCAAGATGAACTGTGG - Intergenic
1067180393 10:43981054-43981076 ACCTTAGTCAAGCAGAACTATGG - Intergenic
1068053932 10:51986623-51986645 ACCTGCTCCAACATGAACTATGG + Intronic
1082974420 11:59058308-59058330 ACCTTCCTCTAAGTTAACTATGG - Intergenic
1082978829 11:59102101-59102123 ACCTTCCTCTAAGTTAACTATGG - Intergenic
1083409496 11:62482112-62482134 ACCTTCATCAAGATGTATTTAGG + Intronic
1100478210 12:94953394-94953416 ACCATCCGCAAAATTAACTATGG - Intronic
1100728476 12:97436264-97436286 ACCTTACTCAAGATGGCATAAGG + Intergenic
1101022115 12:100564127-100564149 TCCTGCCTCAAGACTAACTATGG - Intronic
1102669284 12:114603356-114603378 ACCTTCCTCAAGAGGACTTCAGG + Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1113985925 13:114315512-114315534 TCCTTTCTAAAGATGAACAATGG - Intronic
1114732279 14:25006156-25006178 CTCTTCCTCACGCTGAACTAGGG + Intronic
1115759995 14:36570500-36570522 AACTTCCAGAAGAAGAACTATGG - Intergenic
1117562407 14:56954538-56954560 TCCTTCCTCATGATGAATTCAGG + Intergenic
1124862560 15:33457000-33457022 AGCTACCTGTAGATGAACTATGG + Intronic
1126458215 15:48887746-48887768 ACCTTTAGCTAGATGAACTAAGG + Intronic
1127272054 15:57410358-57410380 ACCATCCTCCATATCAACTAAGG - Intronic
1127689315 15:61379119-61379141 ATCTTCCTCATGTTGAACTATGG + Intergenic
1135509530 16:23070188-23070210 ACCTTCCTGAAGGTGATCTGGGG + Intronic
1138046779 16:53733097-53733119 ACTTTTCTAAAGATGAACTGAGG + Intronic
1140996495 16:80264895-80264917 ACCATCCTCAAGAAGAGCTGGGG - Intergenic
1154223506 18:12478712-12478734 CCCTTCCTCAAAATCAACTTAGG - Intronic
1165587613 19:36933345-36933367 AACTTCCTCAACATGATATAGGG - Intronic
1168589632 19:57622161-57622183 ACCCTCCTCAAGGTGAAATATGG - Exonic
926130704 2:10302133-10302155 ACCTGCCTCGAGAGGAACCAGGG - Intergenic
928127552 2:28626849-28626871 CCCTTCCTCAAAATGAAACAGGG - Intronic
929621634 2:43360540-43360562 AGTTTCCTCAAGATGAGCTTGGG - Intronic
936551315 2:113443272-113443294 ACCTTCCTCAAGATGAACTAGGG + Intronic
938847194 2:135221727-135221749 ACCTGCCTCAAGATGAATAAAGG + Intronic
939560464 2:143725673-143725695 ACCTTCCTCAAGATTTTTTAAGG + Intronic
941552339 2:166932985-166933007 ACAATCCTGAAGAAGAACTAGGG - Intronic
941552414 2:166933717-166933739 ACAATCCTGAAGAAGAACTAGGG + Intronic
947971877 2:234331651-234331673 ACATGACTCAAGATGAAATAAGG - Intergenic
948454715 2:238099645-238099667 ACTTCCCTAAAGAAGAACTATGG + Intergenic
1170715770 20:18829585-18829607 AACTTCATCAAGATGAACACAGG - Intronic
1171068877 20:22046703-22046725 AACTTCCTCAGGGTGAAGTAGGG - Intergenic
1173605535 20:44328340-44328362 ACCTTCCTGTAGAAGAACTACGG - Intergenic
1176588416 21:8613767-8613789 TCTTTCCTCAAGCTGAGCTACGG + Intergenic
1176726411 21:10438513-10438535 TCTTTCCTCAAGAAAAACTATGG + Intergenic
1176903980 21:14477774-14477796 ACCATCCTCAACATGAAAGAAGG + Intergenic
1179309261 21:40182308-40182330 ACAGTCCTCAGGGTGAACTAGGG + Intronic
1180271248 22:10590763-10590785 TCTTTCCTCAAGCTGAGCTACGG + Intergenic
949312770 3:2718912-2718934 ACCTCCCTGAAGATAATCTATGG - Intronic
953288253 3:41634344-41634366 ACCTTCCAGATGAAGAACTAGGG - Intronic
953414340 3:42707065-42707087 TCCTTCCTCAAGATCACCTCAGG - Intronic
957179741 3:76861168-76861190 AACTTCCTCAAGATAAATGAAGG - Intronic
957288754 3:78249729-78249751 ACCTGCCTTTAGCTGAACTAAGG + Intergenic
959480263 3:106864262-106864284 ACCTTACTAAAACTGAACTAAGG + Intergenic
960419075 3:117421269-117421291 ACTTTCATCAAGATGAACTAAGG + Intergenic
961041364 3:123680689-123680711 ACCTTCCTAATGATGAACTTGGG - Intronic
961826920 3:129603971-129603993 TCATTCCTCAGGGTGAACTATGG + Intronic
963641245 3:147863658-147863680 ACCTTACTCTAGATGAACAGAGG - Intergenic
972048074 4:34694077-34694099 ACCTTCCCCAAAAGGAATTATGG - Intergenic
976155481 4:82139671-82139693 ACCTTGCTCAGGATCAATTAAGG + Intergenic
987241756 5:16007099-16007121 ATCTTCCTCAAGAAGACATAAGG + Intergenic
987979711 5:25067217-25067239 ACCTTGCTCTAGATGGATTATGG + Intergenic
991191300 5:63877629-63877651 ACCTCCTTCAACATGACCTATGG + Intergenic
992919475 5:81499848-81499870 AACTTGCTCCAGATGAAGTATGG + Intronic
993329217 5:86576145-86576167 ACCTTCCTCACCATTAACTGGGG + Intergenic
995106788 5:108383900-108383922 ACGCTGCTCAAGATGGACTACGG - Intergenic
999532948 5:152482477-152482499 ACCTTTCACTAGATGAATTACGG - Intergenic
1000270197 5:159676963-159676985 ACCTTCCTCAAGCAGAAGGAAGG + Intergenic
1001907019 5:175481251-175481273 CCAGTCCTCAAGATCAACTATGG - Intronic
1002472658 5:179446042-179446064 TCATTCCTCAAGATGAAATTTGG - Intergenic
1003073825 6:2966030-2966052 TCCTTCCTTAAAATGAAATACGG + Intronic
1011971491 6:93229600-93229622 ACCTCTCTCAAGATGATCTTAGG + Intergenic
1012895612 6:104942631-104942653 ACCTTCCCTAAGATGGACAAGGG - Intergenic
1013211432 6:107990394-107990416 ACCTTCCTAATTATGAGCTATGG + Intergenic
1015074308 6:129136219-129136241 CCCTTACTCAAGATGAGCTTAGG - Intronic
1016977291 6:149821925-149821947 ACCCCCCTCAAGATAAGCTAAGG + Intronic
1019913918 7:4118993-4119015 ACCATCATCATGATGAACTTTGG - Intronic
1020339665 7:7096202-7096224 CCCTTCCTCTAGGTGGACTAAGG - Intergenic
1021105731 7:16637755-16637777 ATCTTCCTCAAGAGAAACTGGGG - Intronic
1026819895 7:73540094-73540116 ATTTTCCTCAAGAGGAACTCTGG + Intronic
1030471715 7:109972328-109972350 ACCTTCCAAAAGATGGACAAAGG + Intergenic
1033581766 7:142744121-142744143 TCCTTCCTCAAGAATAAGTATGG + Intergenic
1034603691 7:152289450-152289472 TCTTTCCTCAAGAAAAACTATGG - Intronic
1038833379 8:31088925-31088947 ACTTGCCTCAAGATGTACTTTGG + Exonic
1041308200 8:56485485-56485507 ACCTTCCTGAAGTTGCAATAAGG + Intergenic
1041330334 8:56717143-56717165 ACATTGCCCAACATGAACTAAGG - Intergenic
1041802237 8:61812875-61812897 AGGTTCCTAAAGATTAACTATGG - Intergenic
1042546626 8:69956907-69956929 AGCTGCCTCAGGATGAATTAGGG + Intergenic
1046046202 8:108967863-108967885 ACCTTCCTTAAGGTCAACTCAGG - Intergenic
1047563502 8:126014426-126014448 ACACTCCTCAAGATCAGCTATGG + Intergenic
1048746466 8:137619778-137619800 ACCTTCCACCTGAAGAACTAGGG - Intergenic
1049901676 9:173839-173861 ACCTTCCTCAAGATGAACTAGGG - Intronic
1050038768 9:1465364-1465386 ACTTTACTGAAGATGAACTTTGG - Intergenic
1053744706 9:41184130-41184152 ACCTTCCTCAGGATGAACTAGGG - Intronic
1054482564 9:65681092-65681114 ACCTTCCTTAGGATGAACTAGGG + Intronic
1054683640 9:68247136-68247158 ACCTTCCTCAGGATGAACTAGGG + Intronic
1056537417 9:87541920-87541942 ACCATTTTCAAGATGAACAAAGG - Intronic
1058953665 9:109926318-109926340 ACCTTCCTAAAGATCACCTGGGG - Intronic
1196682823 X:118486224-118486246 ATGTTCCTCAAGATAACCTATGG - Intergenic
1196742602 X:119038644-119038666 ATGTTCCTCAAGATAACCTATGG - Intergenic
1198392317 X:136188714-136188736 ACCCACCCCAAGATGAACTCCGG - Intronic
1200282612 X:154790587-154790609 AAGTTCCTAAAAATGAACTATGG + Intronic