ID: 1049904428

View in Genome Browser
Species Human (GRCh38)
Location 9:202867-202889
Sequence TCTTCCCTATAAGCAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049904428_1049904431 -10 Left 1049904428 9:202867-202889 CCCACTTCTGCTTATAGGGAAGA No data
Right 1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG No data
1049904428_1049904433 9 Left 1049904428 9:202867-202889 CCCACTTCTGCTTATAGGGAAGA No data
Right 1049904433 9:202899-202921 AAGGGCTGCTACTTCTAACAAGG No data
1049904428_1049904432 -9 Left 1049904428 9:202867-202889 CCCACTTCTGCTTATAGGGAAGA No data
Right 1049904432 9:202881-202903 TAGGGAAGAAAAATGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049904428 Original CRISPR TCTTCCCTATAAGCAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr