ID: 1049904431

View in Genome Browser
Species Human (GRCh38)
Location 9:202880-202902
Sequence ATAGGGAAGAAAAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049904428_1049904431 -10 Left 1049904428 9:202867-202889 CCCACTTCTGCTTATAGGGAAGA No data
Right 1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049904431 Original CRISPR ATAGGGAAGAAAAATGAGGA AGG Intergenic
No off target data available for this crispr