ID: 1049905460

View in Genome Browser
Species Human (GRCh38)
Location 9:212735-212757
Sequence CAGTATGATCTGAGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049905457_1049905460 12 Left 1049905457 9:212700-212722 CCTTCATGGTTAGGTACCAAATA 0: 1
1: 0
2: 1
3: 11
4: 75
Right 1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG 0: 1
1: 0
2: 1
3: 17
4: 183
1049905458_1049905460 -4 Left 1049905458 9:212716-212738 CCAAATACTAAATCTATTGCAGT 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG 0: 1
1: 0
2: 1
3: 17
4: 183
1049905456_1049905460 17 Left 1049905456 9:212695-212717 CCTAACCTTCATGGTTAGGTACC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG 0: 1
1: 0
2: 1
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049905460 Original CRISPR CAGTATGATCTGAGGCAAGA TGG Intergenic
904437053 1:30505880-30505902 CAAAATGAACTGAGGCAAGTCGG + Intergenic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
908045878 1:60167795-60167817 CAGTGTGATCTCAGGCAAAGTGG - Intergenic
908560080 1:65297681-65297703 CAGTCTGGTTTCAGGCAAGAAGG - Intronic
908637452 1:66184024-66184046 CAAGATGATCTGAGGGATGATGG + Intronic
908657117 1:66400273-66400295 CTGCATGATCTTAGGCTAGAAGG - Intergenic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
910394621 1:86779439-86779461 CAGTCTAATCTGAGGCCTGAAGG + Intergenic
916303833 1:163306446-163306468 CATTTTGTTCTGAGGCAAGCTGG + Intronic
916948170 1:169750778-169750800 CAGTGTGTTCTAAGACAAGAAGG - Intronic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
920566436 1:206977228-206977250 CTGTATGATTTCAGGCAAGTTGG - Intergenic
920630407 1:207646072-207646094 CAATACGATCTCAGGCAACACGG - Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924700737 1:246449463-246449485 CAGTGTGATATGGGGCAGGAGGG + Intronic
1064593769 10:16922276-16922298 CAGTTGGATGTGAGGCAGGAGGG - Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1074021361 10:109587727-109587749 CAGTATAATATGAGACTAGAAGG - Intergenic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1075593858 10:123713075-123713097 CAGTAGCATCTGAGCCAGGAGGG - Intronic
1075784782 10:125041729-125041751 CATTATAATCTGAGGCAAGGGGG + Intronic
1077337022 11:2009941-2009963 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1077616960 11:3683073-3683095 AAGTATGATTTGATTCAAGATGG + Intronic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1079268425 11:18958373-18958395 TAGTATGATTTGAGGCCAGCAGG + Intergenic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1084108458 11:66997019-66997041 CAGTCTCAGCTGTGGCAAGAGGG + Intergenic
1087677498 11:101179989-101180011 CAGTATGAACTTGGGCAAGGGGG - Intergenic
1091365909 11:135020154-135020176 CAGTCTGATCTGAGACAAAGGGG + Intergenic
1202820006 11_KI270721v1_random:65123-65145 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1091543279 12:1482235-1482257 CAGTATGAGGTGAGGCACAAAGG - Intronic
1096521717 12:52188264-52188286 CTGTATGATCTAAGGGCAGAGGG - Intronic
1098841939 12:75487707-75487729 GAGTAGGAAGTGAGGCAAGAGGG - Intronic
1099430248 12:82574871-82574893 CAGTATGGTAGGAGGCAAGGAGG + Intergenic
1100844956 12:98648341-98648363 GAGAAAGATCTGAGGGAAGATGG + Exonic
1101013982 12:100480593-100480615 GGGGATGATCTGAGGCTAGAAGG - Intronic
1102162504 12:110781124-110781146 CAGGATGACCTGAGCCCAGAAGG + Intergenic
1103543062 12:121679552-121679574 CTGTATAGTCTGGGGCAAGAGGG + Intergenic
1103734922 12:123054634-123054656 CAGTTTGAACTCAGGCAAAAAGG - Intronic
1109997941 13:70154342-70154364 CTTTATGACCTGAGGTAAGATGG - Intergenic
1111392365 13:87613036-87613058 CAATGTGATCTGAGGCACGTTGG - Intergenic
1111619758 13:90709262-90709284 CAATATGATTTGATGCAAGTTGG + Intergenic
1112875108 13:104027928-104027950 CAGTTTGATTTGAACCAAGATGG - Intergenic
1113463927 13:110501007-110501029 CAGTATGAGCTGCAGCAAGAAGG + Intronic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1119178247 14:72585628-72585650 CAGTGTGATCTTGGACAAGATGG + Intergenic
1119947926 14:78714473-78714495 CTGTATGGTCTCAGCCAAGAGGG + Intronic
1119985537 14:79132981-79133003 GAGCATGATCTTAGGCAAGATGG + Intronic
1121108953 14:91299404-91299426 CAGTAGGAGCTGAAACAAGAAGG + Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1126262858 15:46714588-46714610 CAGAATGATTTGAGGTAGGAAGG - Intergenic
1126651702 15:50929571-50929593 CTGTATCATATGAGGAAAGAGGG + Intronic
1127264359 15:57349536-57349558 CAGCATGCTCTCAGTCAAGAAGG - Intergenic
1129272568 15:74427183-74427205 CAGCATGATCTGAGCGAAGATGG - Intronic
1130013264 15:80168658-80168680 CAGCATAAGCTGAGACAAGAAGG - Intronic
1130134798 15:81173641-81173663 CAGTATGATCTCAGGGAAAGAGG + Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1130854153 15:87826195-87826217 CTCTGTGATGTGAGGCAAGATGG + Intergenic
1143777715 17:9210231-9210253 CAGGAAGGTCTGAGGGAAGAGGG - Intronic
1146083904 17:29809476-29809498 CAGTAAAGTCTGAGACAAGACGG - Intronic
1147501085 17:40964334-40964356 CAACATCATCTGGGGCAAGAGGG + Intronic
1147649587 17:42054302-42054324 CAGCAAGTCCTGAGGCAAGAGGG - Intronic
1149459083 17:56812609-56812631 CAATAGGTTCTGAGGCAAGAAGG + Intronic
1149486555 17:57046806-57046828 ATGCATGATCTGTGGCAAGACGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1163562331 19:18027078-18027100 CAGTGTGATCTGGGGCCAGGAGG - Intergenic
1168099980 19:54136235-54136257 CAGAATGGTCTGAGGCAAGGGGG - Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
926707102 2:15844641-15844663 CATTCTGATCTGAGGGATGAGGG - Intergenic
927151590 2:20199372-20199394 CAGCACGATCTGAGAGAAGATGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927477574 2:23425698-23425720 CAGTCTAATCTAAGGCAAGCTGG - Intronic
928132344 2:28661672-28661694 CAGGATGCTCTGTGTCAAGAAGG - Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928987123 2:37192521-37192543 CATTATTATATAAGGCAAGAAGG - Intronic
929878678 2:45818030-45818052 GAGTATGACCTGAGACAAGAGGG + Intronic
930705956 2:54505335-54505357 CAGTATACTTTCAGGCAAGATGG + Intronic
932515279 2:72340847-72340869 CACTGTGATGTGATGCAAGAAGG - Intronic
932622978 2:73277066-73277088 CAGGATGCTGTGAGGCAAAAAGG - Intronic
934603311 2:95675454-95675476 CTGTATCATCTGTGCCAAGAAGG - Intergenic
936536691 2:113317680-113317702 CTGTATCATCTGTGTCAAGAAGG - Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
939729192 2:145760756-145760778 AAGTAAGATTTAAGGCAAGAAGG + Intergenic
941260667 2:163292733-163292755 CAGTTTGAGCTGAGTCAGGAGGG + Intergenic
941288691 2:163647557-163647579 CTGTGTGATCTGAGGCCAGGTGG - Intronic
942345784 2:175001507-175001529 CAGAAGGGTCTGAGGAAAGATGG + Intronic
943234084 2:185295182-185295204 CATTATGGTCTGAGACAACAGGG - Intergenic
944881109 2:204013879-204013901 CAGGATGAACTTAGGCAAGTAGG + Intergenic
947344441 2:229176321-229176343 GACTATGAGCTGAGGCAAGCAGG - Intronic
948562175 2:238861498-238861520 CTGGATGCTCTGAGGCAAGTCGG + Intronic
1170281609 20:14654902-14654924 CAGTAACATCTTAGGCAAAATGG + Intronic
1172121542 20:32601857-32601879 CAGTATGAGCTGAGGCCAGTGGG + Intronic
1179007934 21:37531142-37531164 CGGTATGATCTGAGACCAAAAGG - Intergenic
1179580453 21:42340150-42340172 CAGTATGGGTTGAGGCAAGAAGG - Intergenic
1181411256 22:22721342-22721364 CAGGATGATGTGAGGCTTGAAGG + Intergenic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1183159485 22:36102426-36102448 CTGTATGATCTTGGGCAAGTTGG - Intergenic
1184567477 22:45300739-45300761 CTGTGTGATCTGGGGCAAGGAGG + Intergenic
949459675 3:4276949-4276971 CAGGATGTTCTGAGGGAAGATGG + Intronic
953632269 3:44629176-44629198 CACAATGCTCTGAGACAAGAGGG + Exonic
954143784 3:48623974-48623996 CAGCATGAGCTGAGGTGAGAGGG - Intergenic
954505699 3:51070702-51070724 CAGTATCAGCTGAGAAAAGATGG - Intronic
955950156 3:64235752-64235774 CAGTCTGATCTGATGAAAGCTGG + Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
958896524 3:99835921-99835943 CAGCATGATCAAAGGTAAGAAGG + Intronic
961106018 3:124242394-124242416 CAGTATGATCTGGAGCCAGATGG + Intronic
961246353 3:125457232-125457254 CAGTATCATCAGAGGCCAAAAGG + Intronic
961602567 3:128072795-128072817 CCGTTTGCTCTCAGGCAAGAGGG - Intronic
962614428 3:137110719-137110741 AAATACCATCTGAGGCAAGATGG + Intergenic
962700621 3:137996150-137996172 CTGTATTATCTGATTCAAGAAGG + Intergenic
964186648 3:153953338-153953360 CACTATTTTCTGAGTCAAGATGG + Intergenic
964663602 3:159148947-159148969 CAGTATGATCTGGGTCACTATGG + Intronic
966631767 3:182084127-182084149 CCGCATGCTCTGAGGGAAGAGGG - Intergenic
971330449 4:25677224-25677246 CAGGCTGATCTGGGGCAAGGAGG - Exonic
971960190 4:33476672-33476694 GAGAATGATATGAGGCAAGAAGG - Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
977036658 4:91961925-91961947 CAGTCAGATCTGAGGCAACTTGG + Intergenic
977723633 4:100268879-100268901 GTGAATTATCTGAGGCAAGATGG - Intergenic
979808028 4:124999560-124999582 AAGAATGATCTGAGGAAAAAAGG - Intergenic
980145910 4:128983542-128983564 CAGAATGATCTAAGGCAAAAAGG + Intronic
982283700 4:153712798-153712820 CAGAATCAAGTGAGGCAAGAAGG - Intronic
983143682 4:164186566-164186588 CAGTATGATCTGAGGTGAAGAGG + Intronic
984153334 4:176162150-176162172 CAATATTATCTATGGCAAGATGG - Exonic
988676956 5:33441955-33441977 CAGAAGGATCTTAGGCAACAAGG + Intronic
989135381 5:38149305-38149327 CTGTGTGATCTTAGGCAACAAGG - Intergenic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
992286663 5:75242461-75242483 CAGACTGATCCCAGGCAAGAAGG + Intergenic
992872053 5:81017068-81017090 CACATTTATCTGAGGCAAGAAGG + Intronic
993843501 5:92910217-92910239 CAGTATAATGTGAAGTAAGAAGG - Intergenic
996123467 5:119697662-119697684 CAGTATCTTCTGAGGCCACAAGG - Intergenic
997357289 5:133271317-133271339 CAGTGTGATGTGCTGCAAGATGG + Intronic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
998939298 5:147263150-147263172 CAGTATTATCAGAGCCAAGTGGG - Intronic
999336501 5:150722664-150722686 CAGTATGATCTGGAGCAACAAGG - Intronic
1000435274 5:161200251-161200273 AAGCATGATTTGAGGGAAGAAGG - Intergenic
1001667788 5:173447581-173447603 CAGGGTTATTTGAGGCAAGAAGG + Intergenic
1001779982 5:174359999-174360021 CAGTACGATTTGAGGGCAGAGGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002931102 6:1635722-1635744 CAGTATCATTTTAGGCAAGTTGG - Intronic
1003679884 6:8242494-8242516 CAGTATTTTCTTAAGCAAGAAGG + Intergenic
1006258367 6:32848884-32848906 CAGCATTATGTGAAGCAAGAAGG + Intronic
1007331719 6:41116238-41116260 CAGTTTTATCTGAGACAACATGG + Intergenic
1010035486 6:71320934-71320956 AAGTATGATTTGACACAAGAAGG - Intergenic
1010750359 6:79610729-79610751 CAGCCTGCCCTGAGGCAAGAGGG - Intergenic
1014672873 6:124328925-124328947 CATTATTATCTGAAGCAAGTGGG - Intronic
1014917752 6:127173245-127173267 CAGAATGATTTGAAGCAAAAGGG - Intronic
1016353489 6:143193205-143193227 CAGTATCAGGTGAGGCAATATGG - Intronic
1017859574 6:158383105-158383127 CAGAATGGTCTAAGGCAAGAGGG - Intronic
1018641982 6:165912456-165912478 CAGAATGGGCTGAAGCAAGAAGG - Intronic
1019128661 6:169858452-169858474 CAACATGATCTGAGGACAGACGG + Intergenic
1019316193 7:388058-388080 CAGCAAGATGTGAAGCAAGATGG + Intergenic
1026365118 7:69640562-69640584 CAGGATGCTCTGAGGCTATAGGG + Intronic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1030538452 7:110798671-110798693 TACTAAGATCTGAGGAAAGATGG + Intronic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1031567166 7:123314530-123314552 CAGCAGGGTCTGAAGCAAGAAGG + Intergenic
1032134700 7:129265249-129265271 CAGCATTATATGAAGCAAGAAGG + Intronic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1034827269 7:154277083-154277105 TAGTATGAGCTAAAGCAAGAAGG + Intronic
1035329457 7:158086664-158086686 CAGTATGAGCTGAAACGAGAAGG + Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1037768163 8:21784376-21784398 TATTATGTTCTGAGGCGAGATGG - Intronic
1037831440 8:22192035-22192057 CAGGATGATCTAGGGCAACAGGG - Exonic
1039978597 8:42387791-42387813 CAGAAAGACCTGAAGCAAGAAGG - Intergenic
1042505014 8:69550525-69550547 CTGTAGGATCTGAGGAATGAAGG + Intronic
1043424867 8:80138687-80138709 AAAAATGAGCTGAGGCAAGATGG - Intronic
1046760980 8:118020217-118020239 CTGTAGGAACTGAGGCCAGATGG - Intronic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1050648377 9:7747123-7747145 CAGTATGTTCAGAAGTAAGAGGG - Intergenic
1051966779 9:22837222-22837244 AAAAATGAACTGAGGCAAGATGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057244937 9:93447145-93447167 CAATATGATCTGTTGCAGGAGGG + Exonic
1057256947 9:93557523-93557545 CAGTATGAGCTGAAACAAGAAGG + Intronic
1060743632 9:126115650-126115672 CTGGATAATCTTAGGCAAGAAGG - Intergenic
1061679770 9:132237255-132237277 CTGTGTGATTTGAGGCCAGAGGG + Intronic
1062501887 9:136855240-136855262 CAGGAGGATCTGAGGGCAGAGGG - Exonic
1186344409 X:8676992-8677014 CAGTGTGGTCTCAGGCGAGAGGG - Intronic
1186606418 X:11097691-11097713 CACAGTGATCTGAGGAAAGAGGG - Intergenic
1186630106 X:11339478-11339500 CTGTATGATCTGAGACAGGCTGG - Intronic
1189391411 X:40580088-40580110 GCCTATGATGTGAGGCAAGAAGG - Intergenic
1189447448 X:41094094-41094116 CATGCTGAGCTGAGGCAAGAGGG + Intronic
1190440881 X:50473130-50473152 TACTATGATATGAGGCAATAAGG - Intergenic
1194957148 X:100194379-100194401 CAGTATGAACAGGTGCAAGAAGG - Intergenic
1195676475 X:107510976-107510998 CTGCATCATCTCAGGCAAGAGGG + Intergenic
1197401559 X:125998113-125998135 CAATTTTAACTGAGGCAAGAAGG + Intergenic
1198241782 X:134794903-134794925 CAGCATGATGTGACACAAGAAGG - Intronic