ID: 1049905794

View in Genome Browser
Species Human (GRCh38)
Location 9:215155-215177
Sequence CCTGGGGCGCCCGGTTCCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049905786_1049905794 9 Left 1049905786 9:215123-215145 CCATTCGCGTCCGCGGCGGGGCG 0: 1
1: 0
2: 0
3: 8
4: 40
Right 1049905794 9:215155-215177 CCTGGGGCGCCCGGTTCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 166
1049905781_1049905794 19 Left 1049905781 9:215113-215135 CCGGACGAGTCCATTCGCGTCCG 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1049905794 9:215155-215177 CCTGGGGCGCCCGGTTCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 166
1049905780_1049905794 25 Left 1049905780 9:215107-215129 CCGAGGCCGGACGAGTCCATTCG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1049905794 9:215155-215177 CCTGGGGCGCCCGGTTCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 166
1049905787_1049905794 -1 Left 1049905787 9:215133-215155 CCGCGGCGGGGCGCGCCTGAGAC 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1049905794 9:215155-215177 CCTGGGGCGCCCGGTTCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049905794 Original CRISPR CCTGGGGCGCCCGGTTCCCG AGG Exonic
900105230 1:978231-978253 TCTGGGGCAGGCGGTTCCCGGGG - Intronic
900105257 1:978369-978391 CCCGGGGCAGGCGGTTCCCGGGG - Intronic
900244340 1:1630624-1630646 CCAGAGGCGCCCGGTCCCCCAGG - Intergenic
900394627 1:2448143-2448165 CCTGGAGCGCCAGGTGCCCCGGG + Intronic
900977435 1:6026257-6026279 CCTGGCGCGCCAGGGCCCCGTGG - Intronic
902311513 1:15584926-15584948 CCGGGTGCGCCCGGGGCCCGGGG - Exonic
903956765 1:27031499-27031521 CCCAGGGCGTCCAGTTCCCGAGG + Intergenic
904411085 1:30325324-30325346 CCTGGGGTGCCCTGTGGCCGTGG - Intergenic
915604046 1:156939763-156939785 CCTGGGGAGCCTGGGTCCCAGGG + Exonic
921190079 1:212700462-212700484 CCTGGGGCGCCCGTGGCTCGGGG - Intergenic
922003340 1:221503502-221503524 CCTGGGTTGCTCGGATCCCGTGG - Intergenic
1065727289 10:28677981-28678003 CCGGGGGCGCACGGGGCCCGGGG + Intronic
1069738365 10:70672389-70672411 GCTGGGGCGCCGGGCGCCCGGGG - Intergenic
1070117572 10:73543598-73543620 CCTGGGGCGGGCGGATCACGAGG - Intronic
1072169983 10:92849093-92849115 CCTGGCGCGCCGGGCTGCCGCGG + Intronic
1072582408 10:96750698-96750720 TCTGGGGCGCCTGGCTCACGAGG + Intergenic
1073294695 10:102432049-102432071 CCTGTGAAGCCCGGTTCCTGAGG + Intronic
1076878945 10:133230764-133230786 CTGGGGGCGCCCGGACCCCGGGG - Exonic
1077266023 11:1650706-1650728 CCTGGGGTGCTCGGGGCCCGAGG + Intergenic
1079033010 11:16999533-16999555 CCTGGGAAGCCAGGTTCCTGGGG - Intronic
1079076971 11:17390075-17390097 CCTGGGTCCCCCAGTGCCCGAGG - Intergenic
1081967903 11:47180502-47180524 CCTCGGCCGCCCGGCTCTCGCGG + Exonic
1083182558 11:60996539-60996561 CCTGGTGGGCCCGCCTCCCGAGG - Intronic
1084174369 11:67415839-67415861 CCCCGGGCGCCCGCTCCCCGCGG + Intronic
1088579039 11:111298997-111299019 CGAGGGGCGCCCGCTGCCCGCGG + Intronic
1089317243 11:117600501-117600523 CCTGGGGCTCCAGGTCCCAGGGG + Intronic
1091704897 12:2687176-2687198 CCTGGGGCTCCTGGGTCCCTGGG - Intronic
1091758459 12:3071710-3071732 TCTGGGGCGCCTGGCTCACGAGG - Intergenic
1092879363 12:12875909-12875931 TCTGGGGCGCCTGGCTCACGAGG + Intergenic
1094843331 12:34351000-34351022 CCTGGGACCCCAGGTTCCCTGGG + Intergenic
1096622680 12:52874318-52874340 CCTGGGGCCCCCGGCCGCCGTGG - Intergenic
1101252528 12:102950325-102950347 CCTGGGGCGCACAGTTTCCCTGG + Intronic
1102457186 12:113077993-113078015 CCGGGGGCGCCCGGGCTCCGTGG - Exonic
1103014055 12:117480369-117480391 CCTGGGGTGCCCCGTTCCCATGG + Intronic
1105202903 13:18194749-18194771 CCTGGGGAGCCCGGTGACCCAGG + Intergenic
1105313460 13:19235157-19235179 CCTGGGGAGCTAGGTTCCTGGGG - Intergenic
1105890541 13:24679896-24679918 CCTGGGGCCCCAGGTTCCTGTGG + Intergenic
1106242574 13:27922692-27922714 CCTGGGGTGCACTATTCCCGGGG - Intronic
1107789480 13:43987235-43987257 CCTTTGGCTCCGGGTTCCCGTGG + Intergenic
1113083020 13:106536353-106536375 CCAGGGGCGCCACCTTCCCGGGG - Intergenic
1113414291 13:110116251-110116273 CCGGCGGCGCCCGGTTCTGGAGG - Intergenic
1113697499 13:112356340-112356362 ACTGGGACGCCTGTTTCCCGCGG + Intergenic
1114066202 14:19061801-19061823 CCTGGGGAGCCCGGTGACCCAGG + Intergenic
1114096066 14:19338223-19338245 CCTGGGGAGCCCGGTGACCCAGG - Intergenic
1114683640 14:24507504-24507526 CCTGGGGTGCTCTGTTCCAGGGG - Exonic
1116620773 14:47200754-47200776 ACTGGGGCGCCTGGCTCACGAGG - Intronic
1119539166 14:75427810-75427832 CCTTGGGCGCCCTCCTCCCGCGG - Intronic
1120211910 14:81641723-81641745 CCTGGGCCGCCCGACTCCAGGGG - Intergenic
1120865481 14:89292413-89292435 CCTGGGTCCCCCAGTTCCCCAGG + Intronic
1122791544 14:104185931-104185953 CCTGGGGCTCCGGGTGGCCGTGG + Intergenic
1122933350 14:104944806-104944828 CCTGGAGGGCCCCGTGCCCGAGG - Exonic
1122934275 14:104948766-104948788 CCTGGAGGGCCCTGTGCCCGAGG - Exonic
1122937565 14:104967107-104967129 CCTGGGACACCCGGTCTCCGAGG - Intronic
1124652396 15:31483578-31483600 GCTGGCGCGCGCGGTGCCCGGGG - Exonic
1129540291 15:76342676-76342698 CCTGGGCCGCCAGGTGCCCAGGG - Intergenic
1132299219 15:100766086-100766108 CCAGGGGAGGCTGGTTCCCGGGG + Intergenic
1132544808 16:528137-528159 CCCGGCGCGCCCGGCCCCCGAGG - Intronic
1132553876 16:564384-564406 TCTTGGGCTCCCGGTTCCTGGGG + Intronic
1135648915 16:24188311-24188333 CCTGGGGCTCGCTGTTCCAGAGG - Intronic
1136505023 16:30697874-30697896 CCTGGGCCTCCCGATTCCCATGG - Intergenic
1136512677 16:30748691-30748713 GCTGGGGCGCCAGGGTCCTGGGG - Intronic
1142469831 17:157131-157153 CCTGGCGCGCTCGGCTTCCGCGG + Intronic
1144225296 17:13139290-13139312 CCTGGGGAGCTCTGTTCCTGTGG - Intergenic
1147134825 17:38428645-38428667 CCTGGGGCGCACGGTGGGCGCGG + Intronic
1148282691 17:46361385-46361407 CCAGGCACGCCCGGCTCCCGGGG + Intronic
1148304909 17:46579310-46579332 CCAGGCACGCCCGGCTCCCGGGG + Intronic
1149994456 17:61399521-61399543 CGAGGGGAGCCCGGGTCCCGGGG - Intergenic
1151967659 17:77439812-77439834 CCTGGGGCGCCTCCTTCCCCTGG + Intronic
1152108147 17:78342437-78342459 CCTGGGGCCTGCGGGTCCCGGGG + Intergenic
1152243218 17:79170856-79170878 CCTGGAGCACCTGGTACCCGGGG - Intronic
1203162151 17_GL000205v2_random:62763-62785 TCAGGGGCGCCAGGTTCCCTGGG + Intergenic
1203162486 17_GL000205v2_random:64063-64085 CCAGGGACGCCAGGTTCACGGGG + Intergenic
1155497600 18:26458162-26458184 GCTGGGTCGCAGGGTTCCCGAGG - Intronic
1160540395 18:79617479-79617501 CCTGGGGGGGCAGGGTCCCGGGG - Intergenic
1160873269 19:1286423-1286445 ATGCGGGCGCCCGGTTCCCGCGG + Intronic
1160909383 19:1467762-1467784 ACTGGAGCGCCCCGTCCCCGCGG - Exonic
1160995321 19:1879680-1879702 CCTGTGGAGCCAGGTTCCCTGGG - Intronic
1161302903 19:3551538-3551560 CCTGGGCCTCCCGCTCCCCGAGG - Intronic
1161550912 19:4911593-4911615 CCTGGGGCGTGTGGTCCCCGAGG + Intronic
1161570246 19:5026625-5026647 TCTGGGGCCCTGGGTTCCCGAGG + Intronic
1161852732 19:6746052-6746074 CCTGGGGGGCCCCGTACCCTCGG + Intronic
1162017618 19:7853856-7853878 CCCGGGGCCCCTGGTTCCTGGGG + Intronic
1162070498 19:8149519-8149541 CCTGCGGCGCCGGGGACCCGGGG + Exonic
1163101720 19:15101351-15101373 CCTGGGGTGCTCAGTTCCTGGGG - Intergenic
1163427091 19:17245733-17245755 CCTGGGTCCCCCGGCGCCCGCGG + Exonic
1164834482 19:31349005-31349027 CGGGGGGCGCCCGGTACCCGAGG + Intronic
1167090639 19:47341426-47341448 CCTGGGGCCCCTGGTGGCCGTGG + Exonic
1167438091 19:49491433-49491455 TCTGGGGCGCCTGGCTCACGAGG + Exonic
1167649476 19:50721529-50721551 CCTGGGGCTCCCGGCAGCCGAGG + Intergenic
1168056326 19:53867135-53867157 CCTGCGGCGCCCGGTGCCAGTGG + Intronic
925390426 2:3490443-3490465 CCTGGGGCGCCAGGCTCATGGGG - Intergenic
925609538 2:5692094-5692116 CCCGGGCCGCCCGCTCCCCGTGG + Intergenic
929313596 2:40452245-40452267 CCCGGGGCGCCCGGCAGCCGCGG - Intronic
936122962 2:109761436-109761458 CCTGGGGCGCCCGGGTGGGGTGG - Intergenic
936556084 2:113499761-113499783 CCTGGGTGGCCCGGCTCGCGGGG - Exonic
937990007 2:127657035-127657057 CCTGGGGGTCAGGGTTCCCGGGG - Intronic
938583907 2:132670641-132670663 CCCGGGGCGCCAGGCTCCCGCGG - Intronic
942966055 2:181892671-181892693 CCTGGTCCGCCCGCGTCCCGGGG + Intronic
945102526 2:206275015-206275037 CCCGGGGCGCCTTCTTCCCGAGG + Intronic
946168530 2:217879841-217879863 CCTGGGGCCCCTGGGTCCCATGG - Intronic
946348375 2:219129764-219129786 CCCGGGGCGCACGGCTCCCCTGG - Intronic
948402003 2:237691744-237691766 CCCGGAGCGCCCGCTTCCCACGG + Intronic
948468345 2:238162754-238162776 CCTGGGCCTCCCGGTCCCCAGGG + Exonic
948508809 2:238449292-238449314 CCTGGGGCGCCCAAGTCCCATGG + Exonic
1168830050 20:841029-841051 CCTGGCGCGCGGGGTCCCCGTGG - Intronic
1168960402 20:1865348-1865370 CCAGGAGCTCCTGGTTCCCGAGG - Intergenic
1175228617 20:57459859-57459881 CCTGGGGAGACCGTTTCCCTAGG + Intergenic
1176381705 21:6117064-6117086 CCGAGGGCGCCGTGTTCCCGGGG + Intronic
1176618748 21:9041412-9041434 CCAGGGTCGCCAGGTTCTCGAGG + Intergenic
1176715054 21:10343256-10343278 CCTGGGGAGCCCGGTGACCCAGG - Intergenic
1177157408 21:17513211-17513233 CCGGGGGCGCTCGCTGCCCGCGG + Intronic
1177757238 21:25362230-25362252 TCTGGGGCGCCTGGCTCACGAGG + Intergenic
1178351021 21:31873303-31873325 CCGGCGGCGCCTGGGTCCCGGGG - Exonic
1179741767 21:43421175-43421197 CCGAGGGCGCCGTGTTCCCGGGG - Intronic
1180099828 21:45579210-45579232 CCAGGGGCGCCCGCATCCCAGGG - Intergenic
1180145691 21:45917410-45917432 CCTGGGGCTCCTGGTGCCCTGGG + Intronic
1180484680 22:15784392-15784414 CCTGGGGAGCCCGGTGACCCAGG + Intergenic
1180603294 22:17036682-17036704 CCTGGGGAGCCCGGTGACCCAGG + Intergenic
1180801389 22:18633782-18633804 CCCGGGCAGCCCGGTTCCCCGGG - Intergenic
1181220332 22:21361479-21361501 CCCGGGCAGCCCGGTTCCCCGGG + Intergenic
1183508505 22:38222097-38222119 CCAGGGGTGCCCGGTTCCACAGG + Intronic
1184146459 22:42614508-42614530 CCTGGGGCCCCCGCGTTCCGGGG - Intronic
1185044495 22:48522403-48522425 CCTGGGGCCGCCGGTGCCAGTGG - Intronic
953881596 3:46693884-46693906 CCAGGGGCCTCCGGATCCCGGGG - Intergenic
954443304 3:50533517-50533539 CCTAAGGCACCCGGTTGCCGCGG + Intergenic
955996552 3:64685726-64685748 CCTGCGGCGCACGTTTCCCTAGG - Intronic
972396396 4:38663317-38663339 CCTGGGGCGACGGGTCCCCCTGG - Intergenic
981475295 4:145180842-145180864 CCCGGCGCGCGCGATTCCCGCGG - Intergenic
985471754 5:51004-51026 CCTCAGCTGCCCGGTTCCCGGGG + Intergenic
985716913 5:1467885-1467907 CCTGGGGTCCACGGTTCCTGGGG + Intronic
985921944 5:2984328-2984350 CCTGGGTCTCCCAGTTCCCATGG + Intergenic
986468868 5:8053506-8053528 CCTGGGTCCCAGGGTTCCCGCGG - Intergenic
987303306 5:16616585-16616607 CTTGGGGCGCCCGGGGCCCCGGG - Intronic
988490548 5:31701662-31701684 CATGGGGCGACCAGTCCCCGAGG + Intronic
997345805 5:133191086-133191108 CCTGGGCCGCCCAGTTCCACTGG + Intergenic
998152310 5:139764482-139764504 CCTGGCGCGCCCGCTCCCTGGGG + Intergenic
999204314 5:149837125-149837147 CCTGGGGCTCCTGGCTCCCCGGG - Intronic
1003503903 6:6724658-6724680 CCTGGGGCGCCCCTTCCCCGGGG + Intergenic
1006472288 6:34235843-34235865 CCTCCCGCGCCCGGTCCCCGAGG - Intergenic
1007032409 6:38640097-38640119 CCTGGGGCCCCCTGTTCTGGAGG - Intronic
1010682122 6:78809303-78809325 CCAGGGGCGCCCATTTCCCTAGG - Intergenic
1017010036 6:150057517-150057539 CAGGGGGCGCCCGGCTGCCGCGG + Intergenic
1018141085 6:160837795-160837817 CCAGGGTCGCCCGGCTCCCCCGG + Intergenic
1019322729 7:422952-422974 CCTGGGGCGCCCGGCCCTCTGGG - Intergenic
1020022821 7:4879166-4879188 CCTGGAGCGCCGGGCACCCGCGG - Intronic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1021678592 7:23106194-23106216 GCTCGGGCCCCTGGTTCCCGGGG + Intronic
1022020945 7:26398818-26398840 CCTGGGGCTCCCGGGACCAGCGG - Intergenic
1023852316 7:44157371-44157393 CCTGGGGCGCCAGGCTCTCAGGG - Intronic
1023867351 7:44244488-44244510 CCTGGGGCCCTCGGGTCCCTTGG + Intronic
1029496393 7:100897229-100897251 CCTGCGGGACCCGGTTCCCGTGG - Intergenic
1029546175 7:101211759-101211781 CCTGGGGAGCCCGGTGCCCAGGG + Intronic
1029640856 7:101817729-101817751 CGGGGGGTGCCCGGGTCCCGCGG + Intronic
1030086475 7:105819900-105819922 CGTGGGGCGCCTGGCTCACGAGG + Intronic
1035458748 7:159026291-159026313 CCTGGGGCGCCCACTTCACGGGG + Intergenic
1035605215 8:926119-926141 CCTGGGCTGGCCGGTTCCTGGGG + Intergenic
1036684184 8:10898257-10898279 CCTGGGTCCCCCGGTACCCAGGG + Exonic
1039920278 8:41888880-41888902 CCTGTGGCCTCCGGTTCCAGTGG - Intronic
1049782400 8:144434964-144434986 CCGGGGGCTCCCGGTGCCTGAGG + Intronic
1049896944 9:117602-117624 CCTGGGCGGCCCGGCTCGCGGGG + Exonic
1049905794 9:215155-215177 CCTGGGGCGCCCGGTTCCCGAGG + Exonic
1053740044 9:41127854-41127876 CCTGGGTGGCCCGGCTCGCGGGG + Exonic
1054443009 9:65283848-65283870 CCTGGGTGGCCCGGCTCGCGGGG + Exonic
1054487271 9:65737653-65737675 CCTGGGTGGCCCGGCTCGCGGGG - Exonic
1054688306 9:68303459-68303481 CCTGGGTGGCCCGGCTCGCGGGG - Exonic
1055308213 9:74952255-74952277 TCCCGGGCGCCCGGCTCCCGGGG - Exonic
1059191826 9:112333799-112333821 TCTGGGGCGCCCTCTTCCCGCGG + Intergenic
1060087429 9:120714757-120714779 TCCGCGGCGCCCGGTGCCCGAGG - Intergenic
1060404408 9:123366136-123366158 GCAGGGGCGCCGGGTGCCCGAGG + Intronic
1061195392 9:129104348-129104370 CCTGGTGCCCCCTGTTCCCCAGG + Intronic
1061207968 9:129175297-129175319 CCCGGGGCGGCCAGTTCCCGTGG + Intergenic
1061534902 9:131241530-131241552 CCTGGGGCGCCTGGCTCACAAGG + Intergenic
1061975855 9:134067806-134067828 CCCCGGGCGCCCGGTTCACCCGG + Intronic
1062598319 9:137309037-137309059 CCTGGGGCGCCTCCCTCCCGAGG + Intronic
1186433398 X:9523370-9523392 CCTGGGGTGCCCCTTTCCCTGGG + Intronic
1190266700 X:48831289-48831311 CCTGGGGCGCCGGGGTCTCTAGG + Exonic
1195599230 X:106727004-106727026 CCGCAGGCACCCGGTTCCCGGGG + Exonic
1201152450 Y:11101501-11101523 CCAGGGTCGCCAGGTTCTCGGGG + Intergenic