ID: 1049905851

View in Genome Browser
Species Human (GRCh38)
Location 9:215353-215375
Sequence AGGCGCCTGGGTAACCGTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049905838_1049905851 19 Left 1049905838 9:215311-215333 CCCTCCAGGTTCTTACAGGTGGC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905839_1049905851 18 Left 1049905839 9:215312-215334 CCTCCAGGTTCTTACAGGTGGCC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905836_1049905851 22 Left 1049905836 9:215308-215330 CCGCCCTCCAGGTTCTTACAGGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905847_1049905851 -9 Left 1049905847 9:215339-215361 CCCAGAAGGGTGATAGGCGCCTG 0: 1
1: 0
2: 0
3: 31
4: 829
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905841_1049905851 15 Left 1049905841 9:215315-215337 CCAGGTTCTTACAGGTGGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905845_1049905851 -3 Left 1049905845 9:215333-215355 CCGGGTCCCAGAAGGGTGATAGG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905833_1049905851 28 Left 1049905833 9:215302-215324 CCCGCTCCGCCCTCCAGGTTCTT 0: 1
1: 0
2: 3
3: 51
4: 463
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905848_1049905851 -10 Left 1049905848 9:215340-215362 CCAGAAGGGTGATAGGCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1049905834_1049905851 27 Left 1049905834 9:215303-215325 CCGCTCCGCCCTCCAGGTTCTTA 0: 1
1: 0
2: 2
3: 22
4: 212
Right 1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049905851 Original CRISPR AGGCGCCTGGGTAACCGTGT TGG Exonic
900758501 1:4454473-4454495 AGCAGCCTGGGTCACCCTGTGGG + Intergenic
903916356 1:26767387-26767409 AGGCTCCTGGGTAGTAGTGTGGG + Intronic
905411235 1:37769901-37769923 TGGCACCTGAGTAACTGTGTAGG + Intergenic
918615028 1:186534315-186534337 AGGAGCCTGGGAAACCAGGTAGG + Intergenic
1068885573 10:62093247-62093269 AGGTGCCTGGGCATCTGTGTTGG - Exonic
1075724832 10:124605899-124605921 AGGGGCCCGGGTCACCCTGTGGG + Intronic
1076772942 10:132676977-132676999 AGGTGCCTGGGTGACGGTGGGGG - Intronic
1079019420 11:16896780-16896802 TGGAGCCTGGGTATCCATGTGGG - Intronic
1083455736 11:62777584-62777606 AGGAGCCTGAGCAACAGTGTGGG + Intronic
1102145064 12:110648925-110648947 AGGGGCCTGGGTACCCCTTTTGG + Exonic
1104750454 12:131235048-131235070 AGGCACCTGCGTCACTGTGTGGG + Intergenic
1106372204 13:29145974-29145996 AGGCACATGGGTAAGAGTGTTGG - Intronic
1132551947 16:557175-557197 AGGGGGCTGGGCAACCGAGTGGG - Intergenic
1134265725 16:12690974-12690996 AGGAGCCGGGATACCCGTGTGGG - Intronic
1148836110 17:50466768-50466790 TGGCGCCTGGGCAAAGGTGTGGG - Intronic
1152097581 17:78280929-78280951 TGGTGCCTGGGTACCTGTGTTGG + Intergenic
1167850119 19:52194873-52194895 GGGCATCTGGGGAACCGTGTGGG + Intronic
934041464 2:88130665-88130687 AGGGACCTGGGGAACCCTGTAGG - Intergenic
940365427 2:152843592-152843614 AGGGGCCTGGGTGAATGTGTTGG + Intergenic
948149044 2:235730251-235730273 AGGAGCCTGTGTGCCCGTGTCGG + Intronic
1169274334 20:4223376-4223398 AGGCACCTGGGGAAGCGTATGGG - Intronic
1171414937 20:24971525-24971547 AGACCCCTGGGTATCCGTGCAGG - Exonic
1172704631 20:36873800-36873822 AAGCACCTGGGTAACCTTGTTGG + Intergenic
1173663696 20:44751037-44751059 AGGCTCCAGGGTCACCCTGTAGG + Exonic
1180001411 21:44997097-44997119 AGGCACCTGGGTATCCCTGGAGG + Intergenic
1181183301 22:21082372-21082394 AGGCGCGTGGGTTACCATGCTGG + Intergenic
1183475063 22:38031590-38031612 AGGCGCCTGGGACAGGGTGTTGG - Intronic
950206555 3:11085243-11085265 AGGAGGCTGGGTCACCCTGTTGG + Intergenic
974101107 4:57418131-57418153 AGGAGCCTTGGAAACCATGTAGG + Intergenic
1015836127 6:137421888-137421910 AGACTCCTGGGGAACCTTGTGGG - Intergenic
1017057674 6:150452766-150452788 AGGCCCATGTGTGACCGTGTGGG + Intergenic
1019399474 7:844088-844110 AGGCGACTGGGCAAGAGTGTGGG + Intronic
1040508821 8:48075592-48075614 AGTCTCCAGGGTAACCATGTAGG + Intergenic
1042773716 8:72405871-72405893 AGGTGTCTGGGGAACCCTGTTGG - Intergenic
1045833459 8:106492165-106492187 AGGTGCCTGGGTCACAGTTTGGG + Intronic
1049303014 8:141881760-141881782 AGGCACCTGTGTAAGCATGTAGG - Intergenic
1049905851 9:215353-215375 AGGCGCCTGGGTAACCGTGTTGG + Exonic
1059335948 9:113568591-113568613 AGGCGCCTGGGGAACAGGCTGGG - Intronic
1062289672 9:135788905-135788927 AAGCTCCTGGGTTACCCTGTAGG - Intronic
1062600918 9:137318276-137318298 GGGCGCCTGGGAAGCCCTGTGGG - Intronic
1194281310 X:91957697-91957719 AGGAGACTGGATAACCATGTTGG + Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic