ID: 1049906026

View in Genome Browser
Species Human (GRCh38)
Location 9:216841-216863
Sequence CTTGCAAGCAACTGCGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049906021_1049906026 -1 Left 1049906021 9:216819-216841 CCGGACTAATCCTACAGGCAGTC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1049906026 9:216841-216863 CTTGCAAGCAACTGCGGGGTCGG No data
1049906018_1049906026 6 Left 1049906018 9:216812-216834 CCGAGACCCGGACTAATCCTACA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1049906026 9:216841-216863 CTTGCAAGCAACTGCGGGGTCGG No data
1049906020_1049906026 0 Left 1049906020 9:216818-216840 CCCGGACTAATCCTACAGGCAGT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1049906026 9:216841-216863 CTTGCAAGCAACTGCGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049906026 Original CRISPR CTTGCAAGCAACTGCGGGGT CGG Intronic
No off target data available for this crispr