ID: 1049911428

View in Genome Browser
Species Human (GRCh38)
Location 9:272251-272273
Sequence AGCGCGCTGGGGAACGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049911428_1049911432 -1 Left 1049911428 9:272251-272273 CCTAAAGCGTTCCCCAGCGCGCT 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1049911432 9:272273-272295 TTTTACAATCTCCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049911428 Original CRISPR AGCGCGCTGGGGAACGCTTT AGG (reversed) Intronic
905033651 1:34903857-34903879 AGAGGGCTGGAGAAGGCTTTGGG + Intronic
918423506 1:184386856-184386878 AGCGCGCTGGGGAGCGGGTTGGG - Intergenic
924823713 1:247518549-247518571 GGCGCCCTGGGGAAGGCTCTCGG + Intronic
1085654441 11:78300079-78300101 AGGGCACAGGGGAACTCTTTGGG - Intronic
1092837394 12:12503633-12503655 AGTGCTCTGGGGCACACTTTGGG - Intronic
1101037092 12:100717006-100717028 AGCGCGCCGGGGAACACATGGGG - Intergenic
1113534256 13:111051798-111051820 AGGGGGCTGGCGAACGCTTGAGG - Intergenic
1117182756 14:53208905-53208927 GGTGCTCTGGGGAATGCTTTTGG + Intergenic
1126498674 15:49320763-49320785 AACAAGCTGGGGAAGGCTTTTGG - Intronic
1132760980 16:1508595-1508617 GGGGCGCTGGGGGATGCTTTTGG + Intronic
1135539301 16:23317640-23317662 GCCGCTCTGGGGAACCCTTTGGG - Intronic
1138341460 16:56292101-56292123 AGCCTGCTGGGGAACGCTGATGG - Intronic
1163785565 19:19273244-19273266 AGCGCCCTGGAGAACGCGTCGGG - Exonic
1164622671 19:29706550-29706572 AGTGCTCAGGGGAAGGCTTTGGG - Intronic
1165826534 19:38708962-38708984 AGGGGGCTGGGGGACACTTTAGG + Intronic
942444347 2:176068065-176068087 TGCGCTCTGGGGAAGGCTTAGGG + Intergenic
946873118 2:224102542-224102564 AGCTCCCTGGGGAACCATTTGGG - Intergenic
962520486 3:136194417-136194439 AGCGAGCCGGGGAAGGCTGTTGG - Intronic
974004342 4:56540783-56540805 AGTGGGCTGGGGAACATTTTGGG + Intronic
985871901 5:2563845-2563867 AGCACACTGGGGTAAGCTTTGGG + Intergenic
993115350 5:83714016-83714038 ACAGAGCTGGGGAACGGTTTGGG + Intronic
1004800691 6:19143884-19143906 AGCGTGCTGGGGAACATTGTAGG - Intergenic
1022112534 7:27240261-27240283 AGAGGGCTGGGGAAGGCTTTGGG + Intergenic
1034885370 7:154794581-154794603 AGCCCGCTGGGGGAGGCTGTCGG - Intronic
1037901752 8:22692847-22692869 AGCGCGCTGGGGATCTCCTCGGG + Exonic
1040339760 8:46434593-46434615 AGCCTGCCGGGGAAGGCTTTGGG + Intergenic
1049911428 9:272251-272273 AGCGCGCTGGGGAACGCTTTAGG - Intronic
1052964827 9:34332077-34332099 AGCAAGCTGGGGAACGAATTAGG - Intronic
1060952726 9:127613788-127613810 CGCTCGCTGTGGAATGCTTTTGG + Intronic
1186771201 X:12819687-12819709 AGGGCGGTGGGGAAAGCGTTAGG + Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic