ID: 1049915332

View in Genome Browser
Species Human (GRCh38)
Location 9:311960-311982
Sequence CACAGCACGTTTAAGTGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049915332_1049915337 -10 Left 1049915332 9:311960-311982 CCCCGCCACTTAAACGTGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1049915337 9:311973-311995 ACGTGCTGTGCGACGTGTCTGGG 0: 1
1: 0
2: 1
3: 4
4: 33
1049915332_1049915338 -5 Left 1049915332 9:311960-311982 CCCCGCCACTTAAACGTGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1049915338 9:311978-312000 CTGTGCGACGTGTCTGGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049915332 Original CRISPR CACAGCACGTTTAAGTGGCG GGG (reversed) Exonic
912523900 1:110266618-110266640 CACAGAACCTTTAAGTGGCAGGG + Intronic
1062893884 10:1088184-1088206 CACAGGAAGTTTGAGTGGTGGGG - Intronic
1067917218 10:50413236-50413258 CACAGCAAGTTAAACTGGCAGGG + Intronic
1069750181 10:70740456-70740478 CACAGCAAGGCTAAGTGGCCTGG + Intronic
1075411731 10:122233462-122233484 CCCAGCACGGTTGAGTGGTGTGG + Intronic
1076005410 10:126944683-126944705 CAGGGCACGTATCAGTGGCGAGG + Intronic
1076618624 10:131772656-131772678 AACAGCACGTTGAAGTGCAGTGG + Intergenic
1081853434 11:46289693-46289715 CACAGCAGGTTTAAGGAGCTGGG + Intronic
1085512009 11:77093248-77093270 TACAGCAGGTTCAAGTGGGGTGG - Intronic
1086430969 11:86736748-86736770 CACAACACGTGTAAGTGGCAGGG + Intergenic
1114292448 14:21299675-21299697 CACAGAAAGGTTAAGTGGCATGG + Intronic
1125483126 15:40093954-40093976 CATAGCTAGTTTAAGTGGCAGGG + Intronic
1126697598 15:51339483-51339505 CACAGAACGTTTGAGTTGGGAGG + Intergenic
1139475498 16:67200642-67200664 CACACCACCTGTAAGGGGCGGGG - Exonic
1142426710 16:90005469-90005491 CCCAGCAAGTTTAAGGGCCGTGG + Exonic
1157473103 18:48004664-48004686 CTCAGAACGTTTGAGTGGCAAGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
929597109 2:43183088-43183110 CACCGGACGTTTAAGTGGGGTGG - Intergenic
939871916 2:147535309-147535331 TACAGCACTTTTAAGAGGAGTGG + Intergenic
944208028 2:197177465-197177487 TAGAGCACATTTCAGTGGCGTGG - Intronic
1173125918 20:40335975-40335997 CACAGAACGTTTAACAGGCCTGG + Intergenic
1183893737 22:40951237-40951259 GACAGCCCCTTTAAGAGGCGTGG + Intergenic
952584431 3:34873750-34873772 CACAGCTCGTTTAACTGGATAGG - Intergenic
953784195 3:45898136-45898158 CACAGCAGGTTTAAGAGGTTGGG - Intronic
955399545 3:58581604-58581626 CAGAGCATGTTTGAGAGGCGGGG - Intronic
959584831 3:108016182-108016204 CACAGCACAATCAAGTGGTGGGG - Intergenic
960618291 3:119615894-119615916 CACAGCACTTAGAAGTGACGTGG + Intronic
964439276 3:156689180-156689202 TACAGCAGGTTTAAGTGGGAAGG - Intronic
977314363 4:95426680-95426702 CACAGAACGTTTTAGTGGTCTGG + Intronic
982880466 4:160707797-160707819 CACAGCAATTTTAAATGACGTGG + Intergenic
989634041 5:43515420-43515442 CAGAGCGCGTTTTAGTGGAGTGG + Intergenic
1001087710 5:168713218-168713240 CACAGCACGTTGGAGGGGCCGGG + Intronic
1024632222 7:51259351-51259373 AAAAGCACTTTTAAGTGGCAAGG + Intronic
1037222927 8:16547509-16547531 CACAGGATGTTTAAGTGCTGTGG - Intronic
1039367370 8:36944448-36944470 CACAGCCTGTTTGAGTGGGGAGG + Intergenic
1049915332 9:311960-311982 CACAGCACGTTTAAGTGGCGGGG - Exonic
1057747214 9:97761953-97761975 CACAGGACGTGAAAGTGGGGAGG + Intergenic
1061041284 9:128142211-128142233 CACAGCACATTTAGTAGGCGGGG + Intergenic