ID: 1049917436

View in Genome Browser
Species Human (GRCh38)
Location 9:331998-332020
Sequence CACTTCCTACGTATGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049917434_1049917436 26 Left 1049917434 9:331949-331971 CCATATCTCTTTTTTACATTGTA 0: 1
1: 0
2: 6
3: 55
4: 593
Right 1049917436 9:331998-332020 CACTTCCTACGTATGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049917436 Original CRISPR CACTTCCTACGTATGTCTCC TGG Intronic
No off target data available for this crispr