ID: 1049919711

View in Genome Browser
Species Human (GRCh38)
Location 9:351910-351932
Sequence AGACAAATCCTGATTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049919711 Original CRISPR AGACAAATCCTGATTCTCAC AGG (reversed) Intronic
903134801 1:21302552-21302574 AGACACATCCAGATCCTCTCTGG - Intronic
907041800 1:51267638-51267660 ACAAAATTCCTGATTCTCAGAGG + Intronic
907071881 1:51543046-51543068 AGAAAAATCCTGTTTCTTATAGG - Intergenic
907612291 1:55884142-55884164 AGGTAAATCCTCATTCTCATAGG + Intergenic
910065428 1:83145236-83145258 ACAAAAATCCTGATCCTCATAGG + Intergenic
911387285 1:97193216-97193238 AGTGAAATCCTGATTCTGAATGG + Exonic
912626337 1:111207531-111207553 AGACCAATTCTGATATTCACTGG + Intronic
914871248 1:151476637-151476659 AGACAAATTCTCACTCTCCCAGG + Intergenic
915218345 1:154354750-154354772 AGACAGGTCATGTTTCTCACTGG - Intergenic
915848646 1:159297321-159297343 AGGCAAAACCTTGTTCTCACAGG - Intronic
917509837 1:175660992-175661014 ACACACATCCTGATTCTGGCTGG - Intronic
919235729 1:194839542-194839564 TCACTATTCCTGATTCTCACTGG + Intergenic
920044342 1:203123853-203123875 AAACATGTTCTGATTCTCACTGG + Intronic
922226356 1:223649349-223649371 AGAGTAAGCCTGTTTCTCACAGG - Intronic
1063344842 10:5301448-5301470 AGAGAAATCCTGCTCATCACTGG + Intergenic
1063415544 10:5869971-5869993 AGAAAAATGCAGATTCTCAGAGG - Intronic
1065434693 10:25694547-25694569 AGCCAGATCCCGGTTCTCACGGG + Intergenic
1067699265 10:48556918-48556940 AGGCAAATCCTGGCTTTCACAGG + Intronic
1070160170 10:73861962-73861984 ACACAAATCCTGCTTCTCCCCGG + Intronic
1071479080 10:86049559-86049581 AGGCAAAGGCTGCTTCTCACTGG + Intronic
1077998074 11:7471076-7471098 AGAGAAAACCTGAGTCTCAGAGG - Intergenic
1081265062 11:41010739-41010761 AGGAAAGTCCTGATTCTCAGTGG - Intronic
1082074088 11:47962813-47962835 AACCAAATCCTAATTCTCAAAGG - Intergenic
1083402994 11:62437115-62437137 AGTCAAATCATGATTCTGTCTGG - Intronic
1083488391 11:62997526-62997548 AGAAAAATCTTGATGCTCAGAGG + Intronic
1084114505 11:67033963-67033985 AGACAAATCCAGATGCTCAGAGG - Intronic
1085814467 11:79722136-79722158 AGAGAGATCCTCATACTCACAGG - Intergenic
1086825667 11:91492426-91492448 ATTGAAATCCTGATTCTCAGCGG + Intergenic
1087706338 11:101496817-101496839 AGAGAAAATCTCATTCTCACAGG - Intronic
1087880254 11:103407336-103407358 AGACAATTTTGGATTCTCACGGG + Intronic
1090146811 11:124333428-124333450 AGATAAATCCTGATTTTTATTGG - Intergenic
1090983810 11:131748333-131748355 AGATAATTCTGGATTCTCACCGG + Intronic
1093285587 12:17256623-17256645 AGCCACATCTTGATTCTCATTGG - Intergenic
1094005598 12:25746866-25746888 AAACAAAGCCTGATACTCAGTGG - Intergenic
1096027632 12:48380808-48380830 TGACTAATCCTGATTATCAAGGG + Intergenic
1096668894 12:53186056-53186078 AGGCACATCCTTATTCACACTGG + Exonic
1101722685 12:107364055-107364077 AGACAAATCCCAAATCTCAGAGG + Intronic
1107230802 13:38107840-38107862 AGACATATTCTGGTTCTCAAGGG - Intergenic
1108185062 13:47880480-47880502 AGAGGAATCCTGTGTCTCACTGG + Intergenic
1109215575 13:59585884-59585906 AGGAAATTCCTGATTCTCAGTGG + Intergenic
1109498667 13:63209802-63209824 ACACAAATTCTGATTTACACAGG - Intergenic
1112011034 13:95294065-95294087 AAACAAGCCCTGATTCTCAATGG + Intronic
1116253899 14:42524991-42525013 AGGCAACTCAAGATTCTCACTGG - Intergenic
1117518855 14:56530269-56530291 AGATGACTCCTGGTTCTCACGGG - Intronic
1119847806 14:77843551-77843573 AGACAAACCCAGATGCCCACAGG - Intronic
1120343238 14:83248626-83248648 AGACCACTCTTGGTTCTCACTGG + Intergenic
1123797028 15:23782522-23782544 AGACGACTCCTGGTTGTCACAGG + Intergenic
1125545040 15:40497192-40497214 AAAAAAATCCTGAATGTCACAGG + Intergenic
1129072072 15:72959979-72960001 AAACAAACTGTGATTCTCACAGG - Intergenic
1139210897 16:65075689-65075711 AGGCAAATCCTAATGCTCCCAGG + Intronic
1141250742 16:82356202-82356224 AGAAAAATCCCGAATCACACTGG + Intergenic
1143210108 17:5179815-5179837 ACACAAATCATGCTTCTGACTGG - Exonic
1144047698 17:11468602-11468624 AGTCCAAGCCCGATTCTCACTGG + Intronic
1144287739 17:13794731-13794753 GGGAAAATCCTGATTCTAACAGG - Intergenic
1149473243 17:56936756-56936778 AAAGAATTCCTGATTCTCACTGG - Intergenic
1150118138 17:62573417-62573439 ATACAAATGTTGATTGTCACCGG + Intronic
1151235778 17:72718941-72718963 AGTCAAATCCTGAATCTACCAGG + Intronic
1153387970 18:4520937-4520959 AGGCAAATCATGGTTGTCACAGG + Intergenic
1155109276 18:22697851-22697873 AGAGGAGCCCTGATTCTCACAGG - Intergenic
1157319355 18:46622476-46622498 AGACATATCCTAACTCTCACCGG - Intronic
1158164465 18:54524011-54524033 AGACAAAACCAGACTCTCAGGGG - Intergenic
1158658552 18:59363407-59363429 AGACAAATCCTGATCTACCCTGG + Intergenic
1161907639 19:7169051-7169073 AGCCAAAACCTGACTCTCCCTGG + Intronic
1162376890 19:10310260-10310282 ACTCAAACCCTGATTCTCAGGGG + Exonic
1166217707 19:41346704-41346726 AAAGAAATCCTCATTCTCACTGG - Intronic
1167850440 19:52197233-52197255 ACACAACTCCTGATTTCCACTGG - Intronic
926662670 2:15485221-15485243 AGACAAATCCTTTTTCTCGGTGG - Intronic
930235713 2:48887134-48887156 AGACAATTCTTGAACCTCACTGG - Intergenic
932201734 2:69834283-69834305 AGACAAATCCAGATTGGAACAGG - Intronic
933650294 2:84844808-84844830 AGCCAAATCCTCAGTCTGACTGG + Intronic
936293561 2:111247711-111247733 ATTCAAATCCTGATTCACTCAGG - Intergenic
937546710 2:123030935-123030957 ATAAAGATCCTGATTCTCATTGG - Intergenic
938616691 2:133006538-133006560 TGACTAAACTTGATTCTCACTGG + Intronic
940980814 2:160000457-160000479 AAACAAATGCTAATTTTCACTGG + Intronic
941817436 2:169811391-169811413 AGCCAAATCCCTATTCTCTCTGG - Intronic
941897814 2:170647155-170647177 ATACATTTCTTGATTCTCACAGG - Intronic
942553491 2:177146317-177146339 AGTCTAAGCCTGATTCTTACTGG - Intergenic
944360593 2:198851020-198851042 AGACATTTTCTGATTATCACTGG - Intergenic
1171016087 20:21543269-21543291 AGAGAAACCCTGATTCTATCTGG - Intergenic
1172197623 20:33102930-33102952 AGGCAATCCCTGCTTCTCACAGG + Intronic
1175075190 20:56366192-56366214 AGCGTAATGCTGATTCTCACTGG - Exonic
1175297114 20:57916072-57916094 AATCAAGTCCTGATTCTCGCTGG - Intergenic
1178973487 21:37201534-37201556 AGGCAGCTCCTGATTCTGACTGG - Exonic
1179431493 21:41324204-41324226 AGACAAATCTTGTCTCTGACAGG - Intronic
949903199 3:8837065-8837087 AGATAATCCCTGATCCTCACAGG - Intronic
952252742 3:31670763-31670785 AGACAAAGCCAGAGTCTCTCCGG + Intronic
952629373 3:35446682-35446704 AGAAAATGCCTGATTCGCACTGG + Intergenic
956831990 3:73060041-73060063 AGTCCAATCTTGGTTCTCACAGG - Intronic
959703556 3:109319981-109320003 AGACACATCCTTATTCCCATGGG + Intergenic
960600425 3:119451979-119452001 ATACGAATTCTGATACTCACTGG + Intronic
961166116 3:124765044-124765066 AAACAAAGCCTCATTCTTACAGG + Intronic
961676892 3:128573091-128573113 AGACACGTCCTCATCCTCACAGG + Exonic
966030875 3:175346522-175346544 AGTCAAACCCTAATTTTCACTGG - Intronic
966545149 3:181138041-181138063 AGTCCCATCCTAATTCTCACTGG - Intergenic
966572932 3:181467369-181467391 AGACACATCCTTTTTCTCTCAGG + Intergenic
968096094 3:195931877-195931899 AGACAAATCCTCAATCTCAGTGG + Intergenic
970294247 4:14611616-14611638 ACACAAATGCTGATCCTTACTGG + Intergenic
972985661 4:44761358-44761380 AGACAAATATTGTTTATCACTGG - Intergenic
974286087 4:59869178-59869200 AGATTAATCCTGATTGTCACAGG + Intergenic
975292949 4:72698233-72698255 AGACACTTCCTGAGTCTCAGAGG + Intergenic
975843100 4:78497455-78497477 AGACAAAACCTGTTTCAAACTGG + Intronic
978522015 4:109626486-109626508 AAAAAAATCCTGATTCTCAATGG - Intronic
980816233 4:137950092-137950114 AAACCAATCCTAGTTCTCACTGG - Intergenic
982094371 4:151908132-151908154 AGACAAATTTTGAGTCTCGCAGG + Intergenic
986620523 5:9668269-9668291 AGACCAAACCTAATTCTCACTGG + Intronic
987647384 5:20691402-20691424 AGCCGAAACCTGTTTCTCACAGG - Intergenic
989489174 5:42030851-42030873 AAAAAAATCCTCATTGTCACTGG + Intergenic
991998246 5:72409824-72409846 CCACAACTCCTGATGCTCACAGG - Intergenic
992987917 5:82252540-82252562 GGACCAATTCTGATTCTTACAGG + Exonic
993292636 5:86095133-86095155 GAACAAATCCTGAATCTCAATGG + Intergenic
995126292 5:108579883-108579905 AGACAAAATTTGATTGTCACTGG + Intergenic
996383130 5:122882598-122882620 TGAAACATCCTGATTGTCACAGG + Intronic
1000587415 5:163117591-163117613 AGAAAAATGCTGATCATCACTGG - Intergenic
1002189268 5:177470281-177470303 AGACAGAGCCTGCTTCTCCCAGG - Intronic
1002958372 6:1891060-1891082 AGCCAACTCCTGATTTTTACTGG + Intronic
1003186323 6:3833888-3833910 AGAGAAAGCCTGACTTTCACTGG - Intergenic
1003960395 6:11203758-11203780 TGTCAAACACTGATTCTCACTGG + Intronic
1005102697 6:22190489-22190511 AAACAAAGCATGATTATCACAGG - Intergenic
1008218643 6:48827030-48827052 TGACACATTCTGATTCTAACTGG - Intergenic
1008323089 6:50142154-50142176 AGACATATCCTTATACTCTCTGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009499073 6:64388728-64388750 AGACAGATCCTGATTTTGGCAGG + Exonic
1011438589 6:87364549-87364571 TGAAAAATCCTTATACTCACAGG - Intronic
1012896964 6:104959753-104959775 AGACAAATCCATTTTCTCTCAGG + Intronic
1015087694 6:129315120-129315142 TGACAAGTCCTGGTTCTCATTGG - Intronic
1016142081 6:140625573-140625595 AGTCAAATAGTGATTATCACTGG + Intergenic
1017268063 6:152474396-152474418 AGACAAATCCAGATTGTCCTGGG + Intronic
1018082987 6:160274813-160274835 GTCCAAATTCTGATTCTCACTGG - Intronic
1019282863 7:209224-209246 ATACAAATGCTTATTCTCACAGG - Intronic
1020571340 7:9866854-9866876 AGACAAATCATGAGTCTCAGAGG - Intergenic
1022197978 7:28087995-28088017 AGACAAGTCCTGCTTCCCAGTGG + Intronic
1024925781 7:54613633-54613655 AGACAAATCTGAATTCTCAAGGG + Intergenic
1027278677 7:76589511-76589533 ACAAAAATCCTGATCCTCATAGG - Intergenic
1027698466 7:81438561-81438583 ACAAAAATCCTCATTCTCATGGG - Intergenic
1027710857 7:81599795-81599817 AGACAAAATGTGAGTCTCACTGG + Intergenic
1029591715 7:101511411-101511433 GAACAAATCCTGATTCTCAAGGG + Intronic
1029647181 7:101865080-101865102 AGGCAAAGCCTCATTCTCTCTGG - Intronic
1030124910 7:106144456-106144478 TGAGATGTCCTGATTCTCACTGG + Intergenic
1030784971 7:113648311-113648333 ATACAAATCATGCATCTCACAGG + Intergenic
1031450952 7:121917344-121917366 ATACAAATCCTGATATTCAAGGG - Intronic
1033973113 7:147067631-147067653 ATACAAATCTTGAATCTGACAGG + Intronic
1034841320 7:154400208-154400230 AGACGCCTCCTGACTCTCACTGG + Intronic
1038861187 8:31390594-31390616 AGAAAAATCTTGTTTCTCTCTGG + Intergenic
1039831572 8:41219427-41219449 TGACTGATCCTGATTCTCAAGGG + Intergenic
1043493026 8:80768531-80768553 AGACAACTACTGATTCTCAATGG + Intronic
1044226192 8:89721521-89721543 TGACAAATGCTGATTAGCACCGG + Intergenic
1045835900 8:106521452-106521474 AGAGAAAGCCTGATTCTGACGGG - Intronic
1048191298 8:132292160-132292182 AGAAAAAGCTTGAGTCTCACTGG + Intronic
1048632705 8:136261250-136261272 AGAAAACTCTTGATTGTCACAGG - Intergenic
1049919711 9:351910-351932 AGACAAATCCTGATTCTCACAGG - Intronic
1050163014 9:2737504-2737526 AGACAATTTCTGCTTCCCACTGG + Intronic
1050584439 9:7095867-7095889 ACACAAATCCTTACTCTCATTGG - Intergenic
1051574618 9:18600593-18600615 AGAGAAGTTCTGATTATCACTGG + Intronic
1052485275 9:29089871-29089893 AGAAAATTCCTTTTTCTCACGGG - Intergenic
1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG + Intergenic
1056334513 9:85553829-85553851 ATCCAACTCCTGATTCTGACCGG + Intronic
1058286361 9:103184803-103184825 AGAATAATCCTCCTTCTCACTGG + Intergenic
1060046366 9:120344514-120344536 AGACAAATACTCATCCTCCCAGG + Intergenic
1061028837 9:128067788-128067810 ACACAAATCCTGTTTCCCACTGG + Intronic
1185588802 X:1260211-1260233 AGAAAAACCCTGTTTCTGACCGG - Intergenic
1186346382 X:8697309-8697331 AGCCCTATTCTGATTCTCACTGG - Intronic
1187812270 X:23192433-23192455 AGGCAAATCCTGATTGTCTCTGG + Intergenic
1189233427 X:39469881-39469903 AGAAAAGTCCTGTTTCTCCCAGG - Intergenic
1189974251 X:46446570-46446592 AGTAAAATCCAGATTCTCCCAGG + Intergenic
1189985081 X:46546093-46546115 AGTAAAATCCAGATTCTCCCAGG - Intergenic
1192162282 X:68797405-68797427 AGACAAATCCTGGTCCTTGCAGG + Intergenic
1194248880 X:91548343-91548365 GTACAAATCATGAATCTCACAGG - Intergenic
1194526448 X:94983395-94983417 AGACACATCCTGGTTCTAAAGGG + Intergenic
1199328106 X:146525505-146525527 AAACACATCCTGATTTTCATAGG - Intergenic
1201959592 Y:19664318-19664340 AGACAAATCCAGGTTGTCAATGG + Intergenic