ID: 1049930055

View in Genome Browser
Species Human (GRCh38)
Location 9:447644-447666
Sequence ATGGAGAAACTGATGAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049930055_1049930059 19 Left 1049930055 9:447644-447666 CCATGGTTCATCAGTTTCTCCAT 0: 1
1: 0
2: 4
3: 28
4: 338
Right 1049930059 9:447686-447708 ATTAAAATAACAAGTATAACAGG No data
1049930055_1049930056 -7 Left 1049930055 9:447644-447666 CCATGGTTCATCAGTTTCTCCAT 0: 1
1: 0
2: 4
3: 28
4: 338
Right 1049930056 9:447660-447682 TCTCCATTATCTAATTAGATTGG No data
1049930055_1049930057 -6 Left 1049930055 9:447644-447666 CCATGGTTCATCAGTTTCTCCAT 0: 1
1: 0
2: 4
3: 28
4: 338
Right 1049930057 9:447661-447683 CTCCATTATCTAATTAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049930055 Original CRISPR ATGGAGAAACTGATGAACCA TGG (reversed) Intronic
903005627 1:20296293-20296315 ACGGAGAAACTGATGGACATGGG - Intronic
903872466 1:26446314-26446336 AGGGAGAAACTGCAGAAGCATGG + Exonic
904014426 1:27409025-27409047 TCGGAGAAACTGATGAAAAATGG + Intronic
904267801 1:29327588-29327610 ATGGAGAAACTGAGGCACAGAGG - Intergenic
904329747 1:29750802-29750824 ATGAAGAAACTGGTGATGCAGGG - Intergenic
904803403 1:33113701-33113723 ATGGAGAAACTAGAGAAACAAGG - Intronic
905299603 1:36977622-36977644 CTGGAGAGACTGAGGACCCAAGG + Intronic
905922835 1:41730580-41730602 ATGCAGCAACTAATGCACCAGGG + Intronic
906043835 1:42811710-42811732 AAGGAGGAACTGATGAACTGGGG + Intronic
907424786 1:54372797-54372819 ATGGATAAACTGAGGCCCCAGGG + Intronic
908022479 1:59912596-59912618 ATGAAAAAACTGAGGAACAAGGG + Intronic
908156357 1:61357591-61357613 ATGGAGACAGTGATGAGCCAGGG - Intronic
908406656 1:63820829-63820851 ATGGAGAAACAGATGAGGAATGG + Intronic
908678207 1:66629965-66629987 ATGAAGAAACTGAGAAACAAAGG + Intronic
909459458 1:75893441-75893463 AGGGAGACACTGATGAACCTGGG + Intronic
910155719 1:84216805-84216827 ATTGAGAATCTGAAGAACCTGGG - Intronic
910751708 1:90638109-90638131 ATGGAGGAAGTCATGAGCCAAGG + Intergenic
911724643 1:101230157-101230179 CTGGAAAAATTGGTGAACCAGGG + Intergenic
912281137 1:108315544-108315566 ATGGATAAAATGCTTAACCAAGG - Intergenic
912558628 1:110534442-110534464 ATGGGGAAACTGAGTCACCAGGG + Intergenic
913687003 1:121241654-121241676 AAGGAGAAACTCATAAAACATGG - Intronic
914038862 1:144029293-144029315 AAGGAGAAACTCATAAAACATGG - Intergenic
914150591 1:145038635-145038657 AAGGAGAAACTCATAAAACATGG + Intronic
915310726 1:155004693-155004715 CTGGAGCAGCTGATGAAACAAGG + Intronic
915731422 1:158056871-158056893 AAGGAGAAACTAAGGCACCAAGG - Intronic
916759481 1:167803628-167803650 ATGAGGAAACTGATGAAAAAGGG + Intergenic
916844583 1:168636744-168636766 AGGGAAAAACTGCTGAATCAGGG - Intergenic
916884124 1:169050632-169050654 ATGGATAAAATGAGAAACCATGG + Intergenic
917397360 1:174608231-174608253 AAGAAGAAAATGGTGAACCAAGG - Intronic
917505414 1:175622905-175622927 ATGGGGAAACAGAGGCACCAGGG - Intronic
919716774 1:200786474-200786496 ATGGAGAAACGCTTGAACCCGGG - Intronic
920474332 1:206260173-206260195 AAGGAGAAACTCATAAAACATGG - Intronic
920505585 1:206513222-206513244 ATGGGGAAACTGAGGAATGAGGG - Intronic
920846025 1:209593694-209593716 AAGGAGAGAATGATGAACCTGGG - Intronic
921290402 1:213651343-213651365 ATGGAGAAGCTGGAGAGCCACGG + Intergenic
921394736 1:214656433-214656455 ATGGAGGATCTGATGAAAAAGGG - Intronic
921540517 1:216408847-216408869 ATGGAGAAGCTGCTGGACAAAGG + Intronic
921955465 1:220979150-220979172 ATGGAGACAATGATCAACAATGG - Intergenic
922114339 1:222596289-222596311 ATGGAGACACTCATTAAACAGGG + Intergenic
923115925 1:230937869-230937891 AAGGAGAAACTGATTGCCCATGG + Intronic
1064624460 10:17248136-17248158 CTGGAGAAACACTTGAACCAAGG + Intergenic
1064964869 10:21004958-21004980 ATGGAGAAACTGGTGAATTAAGG + Intronic
1065676293 10:28177967-28177989 ATGAAAAAACTGAAGAGCCATGG + Intronic
1065845967 10:29743644-29743666 ATGGAGAAGCAGATAAACTACGG - Intergenic
1066213771 10:33266063-33266085 ATGCAGATACTAATAAACCATGG - Intronic
1066339225 10:34513370-34513392 ATGGAGAATCTCTTGAACCCGGG - Intronic
1067851165 10:49755454-49755476 AGGGGGAAATTGATGAAACAAGG + Intronic
1068588973 10:58833965-58833987 TGGGAGAAACTGAGCAACCAGGG - Intergenic
1069517476 10:69090049-69090071 AGGGAGAAACTGACAAACTAGGG + Intronic
1069704101 10:70446749-70446771 ATGGAGAAACTGAGGTACACAGG + Intronic
1071522184 10:86338243-86338265 ATGGATAAGCACATGAACCAGGG + Intronic
1071844129 10:89504354-89504376 TTAGAGAACTTGATGAACCAGGG - Intronic
1074790801 10:116885878-116885900 ATGGAGAAACTGCAGCAGCATGG - Exonic
1075567870 10:123517953-123517975 ATGGGGAAACTGAGGTCCCATGG - Intergenic
1077837522 11:5937670-5937692 AGGGAGCATCTGTTGAACCACGG - Intronic
1078193189 11:9110436-9110458 ATGGAGAAACTCAGGAACTGTGG - Intronic
1078762365 11:14261460-14261482 ATGGAGAAACTGAGGAACAGAGG - Intronic
1079764493 11:24374490-24374512 ATGGAGAAAATGATGGATCTAGG - Intergenic
1080037916 11:27728773-27728795 AAGGAGAGACTGAAGAACAATGG + Intergenic
1080538719 11:33246205-33246227 ATGGAGAAACTCATTTAGCAAGG - Intergenic
1081934196 11:46893690-46893712 AAGGAGAAACTCTTGAACCCAGG - Intronic
1081998533 11:47379185-47379207 ATGGGGAAACTGAGAAACCTGGG - Intergenic
1082826292 11:57582114-57582136 ATGGAGAAAGAGATACACCAAGG - Intergenic
1083204948 11:61143069-61143091 ATTGAGAAACTGAGGCACAAAGG - Intronic
1083229879 11:61310078-61310100 ATGGATAATCTGATGAGACAGGG - Intronic
1083268778 11:61560109-61560131 ATGGGGAAACTGAGGAACAGAGG + Intronic
1084710375 11:70840382-70840404 ATGGGGAAACTGAGGCTCCAGGG - Intronic
1084992008 11:72934859-72934881 ATTGAGAAACTGAGAAACCATGG + Intronic
1085173276 11:74466576-74466598 ATAGGGAAACTGATGCCCCAGGG - Intronic
1085639401 11:78183154-78183176 CTGGAGAAACTGATGATTCCTGG + Intronic
1085763886 11:79265283-79265305 AATGTGAAACTGAAGAACCAAGG - Intronic
1086621203 11:88888374-88888396 ATAGAGAAAGTGAAGAAACAGGG + Intronic
1087054357 11:93919111-93919133 ATGAGGAAACTGATGCTCCAAGG + Intergenic
1089686704 11:120154206-120154228 ATGGAAAAAGTCATGAGCCAGGG - Intronic
1090060548 11:123460898-123460920 AAGGAGAAGCTGATGCACCTGGG - Intergenic
1091930427 12:4391375-4391397 ATTGAAAAGCTGTTGAACCAAGG + Intergenic
1092006496 12:5074588-5074610 ATGGAGCCACCGATGAGCCAGGG + Intergenic
1092097423 12:5854234-5854256 AACGAGAAACTGAAGAACAACGG - Intronic
1093051334 12:14508261-14508283 ATGAAGAAACTGAGGCACAAAGG - Intronic
1093852398 12:24056494-24056516 ATGGAGAAATAGAGCAACCATGG - Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1097016740 12:55992636-55992658 ATGCAGAAAGTGGTGAACCCAGG + Exonic
1097018625 12:56004690-56004712 ATGGAGAGACTGTAGAATCAGGG + Exonic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097625777 12:61998589-61998611 ATGGGGAAACTGAAGCTCCAAGG + Intronic
1101269535 12:103129202-103129224 AGAGAGAAACTGCTGAAGCAAGG + Intergenic
1101527783 12:105547498-105547520 AGGGATAAAGTGATGGACCATGG + Intergenic
1102029342 12:109731036-109731058 ATGGAGAAACTGAGTCCCCAAGG + Intronic
1103985836 12:124767013-124767035 AATGAAAAACTGATGAACTAAGG - Intergenic
1104723994 12:131065003-131065025 AGGGAGAATCTGATGAATGAGGG - Intronic
1104778338 12:131404286-131404308 ATGGAGAAACTGAGGCACATGGG - Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106439361 13:29751788-29751810 TTGGAGAAACTGATGATGTAAGG + Intergenic
1106444204 13:29810114-29810136 ATGGAGAAACTGAGGAATTAAGG + Intronic
1106916984 13:34526310-34526332 ATGGAGAAATAGACAAACCAAGG - Intergenic
1108556831 13:51601700-51601722 ATGTAGAAACTGATGCAGCTAGG + Intronic
1111203126 13:84965877-84965899 ATGAAGAAACTGAGTATCCATGG - Intergenic
1111723851 13:91979818-91979840 ATCCAGAATCTGTTGAACCAAGG - Intronic
1113264308 13:108600188-108600210 AGGGGGAAATTGATGAACAAAGG + Intronic
1114582069 14:23771165-23771187 ATGGAGAAACTCATGTCACAGGG + Intergenic
1117000918 14:51370420-51370442 CAGGAGAATCTGTTGAACCAGGG - Intergenic
1118784319 14:69033502-69033524 ATGAAGAAACTGAGGCTCCAGGG - Intergenic
1118805956 14:69237130-69237152 ATGATGAACCTGGTGAACCAGGG + Intronic
1119708902 14:76806984-76807006 AGGGGGAACCTGCTGAACCAAGG - Intronic
1120997806 14:90429704-90429726 ATGAAGAAACTGAGGAAACCGGG + Intergenic
1121224231 14:92309531-92309553 ATGGGGAAACTGAGGCACCGAGG + Intergenic
1122363117 14:101179170-101179192 AAGGAGAAGCTCTTGAACCAGGG + Intergenic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1123984594 15:25633963-25633985 ATGTAGAAACTGCAGCACCAAGG - Intergenic
1124694472 15:31852398-31852420 ATGGAGAAACTAAAAAACTAAGG + Intronic
1126434229 15:48619429-48619451 AGAGAGAAACAGATGGACCATGG - Intronic
1127652782 15:61025136-61025158 ATGTATAAAATGATGAGCCAGGG + Intronic
1128358513 15:66944526-66944548 ATGGGGAAACTGAGGCTCCATGG - Intergenic
1130315913 15:82796388-82796410 ATGGAAACACAGGTGAACCAAGG + Intronic
1130741967 15:86610533-86610555 AGGGAGAAACAGATAAACAAAGG + Intronic
1131399961 15:92116577-92116599 AAACAGAAACTGGTGAACCAAGG - Intronic
1131472639 15:92710067-92710089 ATGCAGAAATTAGTGAACCAGGG - Intronic
1131886436 15:96919516-96919538 ATGGATAAATGGATAAACCATGG - Intergenic
1134068340 16:11244727-11244749 ATGGAGGAAAGGAGGAACCAGGG - Intergenic
1134867584 16:17621999-17622021 ATGGAAACACTGAGGATCCAAGG - Intergenic
1135181223 16:20276232-20276254 ATGGAGAATCTGAAGACCCCTGG - Intergenic
1135229220 16:20689942-20689964 ATGAAGAAACTGAGGTTCCAAGG - Intronic
1135424726 16:22326671-22326693 ATGAAGAAACTGAGGCTCCAAGG + Intronic
1135743223 16:24994694-24994716 AGGAAGAAACTGATGCACCCAGG + Intronic
1137321426 16:47387067-47387089 ATGGAGCAATTTATGACCCAAGG + Intronic
1137688714 16:50404933-50404955 TTGGAGAAACTGAGGCATCAAGG - Intergenic
1137767929 16:50992053-50992075 ATGGAGAAACTGAGGCTCAAGGG + Intergenic
1137930271 16:52580549-52580571 GGGGAGAAACTGATGAATTAAGG + Intergenic
1137964623 16:52918083-52918105 ATGGAAAAAGTGATGACCCATGG - Intergenic
1138368770 16:56507300-56507322 AGGAAGAAACTGGTGAACTAAGG - Intronic
1138526384 16:57610132-57610154 ATGGAGAAACTGAGGCACCAAGG + Intergenic
1138781549 16:59794595-59794617 TTGGAGAAACTGATAAAGCTGGG + Intergenic
1138968068 16:62110306-62110328 CAGGAGAAAATGATGAACTAAGG - Intergenic
1139068950 16:63356418-63356440 ATGTAGATATTGATGGACCAGGG + Intergenic
1139370842 16:66468588-66468610 GTGGAGTAACTGAGCAACCATGG + Intronic
1140141288 16:72260448-72260470 ATGGAATAACTGATGGAACAGGG + Intergenic
1140736135 16:77899386-77899408 AGGTAGGAACTGATGAACCAGGG - Intronic
1140829145 16:78735330-78735352 CTGGAGAACCTGATGACCAATGG - Intronic
1140918855 16:79518588-79518610 ATGTGGAAACTGAGGCACCAAGG - Intergenic
1141530437 16:84642938-84642960 ATGGAGAAACTGAGGCACAACGG + Intergenic
1145763368 17:27440855-27440877 CTGGAGAATCTCATGAACCCGGG - Intergenic
1146163261 17:30571073-30571095 AGGGAGAAACTGAGGCTCCAAGG + Intergenic
1146587514 17:34095057-34095079 ATGGAGAAACTGAAGACCCAGGG - Intronic
1146605769 17:34256458-34256480 ATGGGAAAACTGAGGCACCAAGG + Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147455200 17:40533396-40533418 CAGGAAAAACTGAAGAACCAGGG - Intergenic
1147580236 17:41623832-41623854 AGGGAGAAACTGAGGCTCCAAGG + Intronic
1147724405 17:42557599-42557621 AAGGAGAATCTCTTGAACCAGGG + Intergenic
1147736529 17:42642303-42642325 ATGCAGGAAGGGATGAACCACGG - Intergenic
1150264860 17:63825681-63825703 ATGGACAAATGGCTGAACCAGGG - Intronic
1150542974 17:66122716-66122738 ATGGAGCAATTTATGACCCAGGG - Intronic
1150872651 17:68930662-68930684 ATAGAGAACCTAATGAACAAGGG + Intronic
1150997743 17:70338599-70338621 ATGGAGAAACTGAAGATCAGTGG - Intergenic
1151624187 17:75266447-75266469 ATGGGTAAACTGAGGCACCAAGG + Exonic
1151934531 17:77253962-77253984 TTGAAGAAAGTGATGAACCCAGG + Intergenic
1152365700 17:79855155-79855177 ATGGAGAAACTGAGGCACAGGGG - Intergenic
1153068450 18:1076626-1076648 ATGGAGACACATATTAACCATGG + Intergenic
1153261634 18:3229881-3229903 ATGGAGAATCAGTTGAACCCAGG + Intergenic
1156315159 18:35962809-35962831 AGGGAGAAACAGAGGCACCAAGG + Intergenic
1156828786 18:41466009-41466031 ATGGAGGAACTTATGAAGCTTGG - Intergenic
1156937803 18:42732238-42732260 AGAGAGAAACTGAGGCACCAAGG - Intergenic
1158551282 18:58438241-58438263 ATGGAGAACCAGTGGAACCAAGG - Intergenic
1159102056 18:63968729-63968751 AAGGAGAAATTGATGCACAATGG + Intronic
1159529619 18:69639142-69639164 TAGGAAAAACAGATGAACCAAGG + Intronic
1160611243 18:80087493-80087515 ATGGAGAAACTGTAGATGCAAGG + Intronic
1160729650 19:635325-635347 ATGGGGAAACTGAAGTGCCAGGG - Intergenic
1160850127 19:1186927-1186949 AGGGAGAATCTCTTGAACCAAGG + Intronic
1161313786 19:3608644-3608666 ATGGGGAAACTGAGGCACAAAGG + Intergenic
1161626535 19:5330297-5330319 ATGGGGAAACTGAGGCACAAAGG - Intronic
1161666199 19:5578466-5578488 AAGCAGAAACAGATGAACCCAGG - Intergenic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1162027323 19:7901778-7901800 TTTGAGAAACTGATGAAGCCAGG + Exonic
1164504082 19:28843802-28843824 ATATAAACACTGATGAACCAGGG + Intergenic
1166803478 19:45471626-45471648 ATGGAGAAACTGAGGCAAAATGG - Intronic
1167050103 19:47072646-47072668 GTGGAGGAACTGAAGAAGCAGGG - Exonic
1167658047 19:50779201-50779223 AGGGAGAAACTGATCTTCCAGGG + Intergenic
1167870533 19:52365846-52365868 GTGGTGAAACTGAGGAACGATGG - Exonic
1167961611 19:53109513-53109535 GTGGTGAAACTGAGGAACCATGG + Exonic
1168383981 19:55947673-55947695 ATGGAAAAACTGAAGATGCATGG - Intergenic
1168401964 19:56090289-56090311 AGGGAGAAACTGAGGCACTAGGG + Intronic
925380842 2:3424857-3424879 ATGTACAAACAGATGCACCAGGG - Intronic
926366929 2:12141888-12141910 ATAGAAAAACTGATGAAGCAGGG + Intergenic
926404624 2:12538563-12538585 CTGGAGAGACTGATTAACTAAGG + Intergenic
926692270 2:15745753-15745775 ATGGAGAAACTGAGGCACAGAGG + Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
928575886 2:32654786-32654808 AAGGAGAATCTCATGAACCCGGG - Intronic
929147978 2:38723062-38723084 ATTGAAAAACTGATGAATGAAGG - Intronic
930064408 2:47316835-47316857 CAGGAGAACCTGTTGAACCAGGG - Intergenic
931638243 2:64359836-64359858 CTGGAGAAAGGGATGAAACAGGG - Intergenic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
932792078 2:74662510-74662532 AGGAATAAACTGATGAACAAAGG + Intronic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
936909737 2:117577767-117577789 AGGGAGAAACAAATGAAGCAGGG + Intergenic
937738038 2:125314866-125314888 ATGGAGAAATTGAGGAATAATGG - Intergenic
938212782 2:129482696-129482718 ATGGAGAAACTGATGTTCCCAGG + Intergenic
941853730 2:170209142-170209164 TTGGAGAAACTGTTTTACCAAGG - Intronic
942900351 2:181109387-181109409 ATGGAGAATCTCTTGAACCGGGG + Intergenic
944513227 2:200484839-200484861 ATGGAGAAACTGAAGCACAGAGG - Intergenic
945374505 2:209063776-209063798 ATGGAGAATCTGATGAATGCAGG - Intergenic
945876161 2:215280084-215280106 GTGGAGTAACAGATGAACAAAGG - Intergenic
946670642 2:222100172-222100194 AGGGAGATACTCATGAACCTGGG - Intergenic
948049213 2:234967107-234967129 ATCGGGAAACTGAGGAACCATGG + Intronic
948144300 2:235696889-235696911 CTGGAGAATCTCTTGAACCAGGG + Intronic
1168933794 20:1645896-1645918 ATGGAGAAACTGAGGACTCAAGG + Intronic
1170751097 20:19145939-19145961 ATAGAGCAACTCATGAACCCAGG - Intergenic
1171044711 20:21798906-21798928 GTGGAGAAACACATGAACCTGGG + Intergenic
1172686391 20:36758778-36758800 CAGGAGAATCTGTTGAACCAGGG - Intronic
1172814534 20:37675937-37675959 ATGGAAAAACTGATGGACATGGG - Intergenic
1173183278 20:40820556-40820578 GTGGAGACACTGGAGAACCATGG - Intergenic
1173957941 20:47049037-47049059 ATGGAGAAACTGAGGCACAGAGG + Intronic
1174161114 20:48551133-48551155 ATGGAGAAACTGAGGCACACAGG - Intergenic
1174923519 20:54731325-54731347 ATTGAGAAACTGAAGATCAAAGG + Intergenic
1175130575 20:56786430-56786452 ATGAAGAAACTGAGGCTCCATGG - Intergenic
1178195707 21:30343150-30343172 TTGGAGAAAAGAATGAACCATGG + Intergenic
1179373202 21:40826135-40826157 AAGGAGAAACTGAACAATCAAGG + Intronic
1179464244 21:41561230-41561252 GTGGAGAAACTGAGAAACCGAGG + Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1180883784 22:19225195-19225217 ATGGAGAAACTTATGGAGCCCGG - Intronic
1181072258 22:20352571-20352593 GTGGAGAAACTGAAGGGCCAAGG + Intronic
1181869409 22:25886089-25886111 ATGGGGAAACTGAGGCACCAAGG - Intronic
1182080374 22:27524508-27524530 ATGGAGCAGCTGGGGAACCAGGG + Intergenic
1182307117 22:29377880-29377902 ATGAGGAAACTGAAGTACCAGGG + Intronic
1182987211 22:34731616-34731638 ATGGAGAGAGTGCTGGACCACGG - Intergenic
1183293822 22:37018712-37018734 GTAGAGCACCTGATGAACCATGG + Exonic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1184451141 22:44583588-44583610 ATGGGGAAACTGATTATCCCAGG + Intergenic
1185087047 22:48746590-48746612 ATGGAGAAACTGAGGCACAGGGG + Intronic
1185159886 22:49217261-49217283 ATGGAGCAACTTATGTACCAGGG + Intergenic
949301952 3:2594378-2594400 CTGGAGTAACTGGTTAACCAGGG + Intronic
951308921 3:21099920-21099942 TGGGAGAAACTGAGAAACCAAGG - Intergenic
951397845 3:22192040-22192062 ATGGAGAAAGAGATGAATGATGG - Intronic
951748110 3:26001979-26002001 ATGGAGAAATAGAGGAACAAAGG + Intergenic
952203762 3:31158374-31158396 ATGGAGAAAGTCATTAATCAAGG - Intergenic
953843819 3:46410917-46410939 ATGCAGATACTGCTGACCCAAGG + Intronic
954306052 3:49726033-49726055 ATGGACAAACTGATGGACCCAGG + Exonic
958060654 3:88475744-88475766 ATGAAGAAAATGATTCACCAAGG + Intergenic
958802508 3:98772809-98772831 AGGGTGAAACTGATGAAACCTGG - Exonic
960429086 3:117546946-117546968 AGGCAAGAACTGATGAACCAAGG + Intergenic
960980089 3:123215811-123215833 ATGGAGAGAGAAATGAACCAGGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
964136862 3:153353886-153353908 CAGGAGAAACTCTTGAACCAGGG + Intergenic
964223881 3:154374712-154374734 ATGGCAAATCTTATGAACCAAGG + Intronic
965225073 3:165978392-165978414 TTGGAGAGACTGAAGAATCAGGG + Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967730307 3:192900985-192901007 TTGAAGAAACTGATGAAGGATGG + Intronic
967746665 3:193063520-193063542 ATCTAGAAACTGATGACCTATGG - Intergenic
968873981 4:3255609-3255631 ATGGGGAAACTGAGGCCCCAGGG - Intronic
970136074 4:12925438-12925460 ATGTACAAACTGAAGATCCAGGG - Intergenic
970575813 4:17426549-17426571 ATGGAGGAGCTGGTGAACCAAGG + Intergenic
971202814 4:24528122-24528144 ATTAATATACTGATGAACCAAGG + Intronic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
972302870 4:37801874-37801896 ATGAGGAAACTGAGGCACCAAGG + Intergenic
972473841 4:39432311-39432333 ATGGAGAAAATGAGAGACCAGGG + Intronic
973084187 4:46033449-46033471 AAGAAGAAACTAATGAGCCAGGG - Intergenic
974626114 4:64430883-64430905 ATGGAGAAGCTGCTGCAACAGGG + Intergenic
976496303 4:85733690-85733712 AGGGAGAAGGAGATGAACCAAGG - Intronic
976729371 4:88246337-88246359 AAGGATACACTGATGAACAAAGG - Intergenic
976796072 4:88934431-88934453 ATGGATAAAATAATGGACCATGG - Intronic
976931780 4:90575047-90575069 AAGGAGAAAGTGATGAACCAGGG - Intronic
979633330 4:122928267-122928289 AAGGAGAAACAGCTGAAACAAGG - Intronic
981100811 4:140827257-140827279 ATGGAGAAACTGAGAAACCTAGG + Intergenic
981488608 4:145315524-145315546 ATGGAGCAACTGAAGAAACTGGG + Intergenic
981548475 4:145918594-145918616 ATGAAGAAACTGAGGCACAAAGG - Intronic
982179115 4:152733518-152733540 AGGGGGAAACTGATGAAGAAAGG + Intronic
982896886 4:160941541-160941563 ATGGAGATGCGGATGGACCATGG + Intergenic
984042516 4:174752951-174752973 ATGGAGAACATGAAGAAACATGG - Intronic
986165370 5:5267961-5267983 TAGGAGACACGGATGAACCATGG + Intronic
986256806 5:6107654-6107676 ATGGAGAATCACTTGAACCAGGG + Intergenic
986412204 5:7492390-7492412 ATGGCAAAACTGCTGAAACATGG - Intronic
987649621 5:20724226-20724248 ATGAAGAATCTGGTGAACTAAGG + Intergenic
987794107 5:22605878-22605900 ATGGAGATGCAGATGACCCATGG - Intronic
988745943 5:34137307-34137329 ATGAAGAATCTGGTGAACTAAGG - Intergenic
989458042 5:41664906-41664928 ATGGAGAACCTGATAGACCTTGG - Intergenic
989857875 5:46321270-46321292 TTTGAGAAACTGCTGAAGCATGG - Intergenic
990976395 5:61565145-61565167 ATGGTGAAACTGATGATGCGTGG - Intergenic
991622253 5:68557018-68557040 AGGGAGAAAGTGAAGAACAAAGG + Intergenic
992680040 5:79144281-79144303 TTGGTTAAAGTGATGAACCATGG - Intronic
992682808 5:79169608-79169630 GTGGATAAACTCATGAACCTGGG - Intronic
993418795 5:87673586-87673608 ATGGAGAAACGGAAAAAGCAAGG - Intergenic
993432013 5:87843246-87843268 ATTGAGCCACTGCTGAACCATGG + Intergenic
993485006 5:88473099-88473121 ATGGGGAAAATGAAGAACTAAGG - Intergenic
993880441 5:93354269-93354291 ATGAGGAAACTGAGGCACCATGG - Intergenic
994334141 5:98544583-98544605 ATGCATAAACTGATGAAATAAGG + Intergenic
994640366 5:102401020-102401042 ATGGAGAAAATAATAAAACAAGG + Intronic
995288946 5:110427228-110427250 ATGAAGAAACTGAAGAACAGAGG - Intronic
998266510 5:140671287-140671309 ATGGAGTCACTGTTTAACCATGG + Exonic
999319892 5:150607590-150607612 ATGAAGAAACTGAGGAACAGAGG + Intronic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000566589 5:162855391-162855413 GTAGAGAAATTTATGAACCAAGG + Intergenic
1000629011 5:163570702-163570724 ATGGAGAAACTGAGGCACATGGG + Intergenic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1001654538 5:173339548-173339570 ATGGAGAAACTTCTGAACATGGG + Intergenic
1003149263 6:3534964-3534986 ATGGAGAAACAAAGGATCCAAGG - Intergenic
1005481184 6:26256956-26256978 ATGGAGAAAATAATGTCCCATGG + Intergenic
1005876396 6:30013356-30013378 ATTAAGAAACTGAGGCACCAGGG + Intergenic
1006105809 6:31715623-31715645 AGGGAGAAACTGAGGACTCACGG - Exonic
1006822593 6:36910004-36910026 ATGAGGAAACTGATGTGCCAAGG + Intronic
1007271339 6:40639599-40639621 ATGGAAAAACGGAGGAACAAAGG - Intergenic
1009014886 6:57887210-57887232 ATGAAGAATCTGGTGAACTAAGG - Intergenic
1009848599 6:69165871-69165893 ATGAAGAAACTGAGGCACAAGGG + Intronic
1009987423 6:70797777-70797799 AAAGATAAACTGATGAACCTAGG - Intronic
1010837434 6:80607501-80607523 ATGGAGAAACTGAAAAAGCCTGG + Intergenic
1012451669 6:99358976-99358998 ATGGAGAATCGGTTGAACCCAGG - Intergenic
1013814610 6:114083147-114083169 AAAGAGAGACTGATGAAACAGGG + Intronic
1014811340 6:125889694-125889716 ATGGAAAAAGTATTGAACCAGGG + Exonic
1015324360 6:131907725-131907747 ATGGGAAAACTGGTGAAACAAGG - Intergenic
1015368953 6:132428873-132428895 ATGGAGGAAATGTTGAACCCAGG - Intergenic
1017451526 6:154558725-154558747 AAGGAAAAGCTTATGAACCACGG - Intergenic
1017562077 6:155638962-155638984 CTGGAGAAACTGAATAACCCGGG - Intergenic
1018599478 6:165524583-165524605 ATGAAAAAAATGATGAACCCAGG + Intronic
1018684161 6:166290276-166290298 AAGGAAAAACTGAAGAACCAAGG - Intergenic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1022431108 7:30321817-30321839 ACTGTGAAACTGATCAACCATGG - Intronic
1022578477 7:31522987-31523009 ATGAAGAAACTGAAGATCCAAGG - Intronic
1023407501 7:39850128-39850150 ATGGAGAATCTGTAGAACGATGG - Intergenic
1023462401 7:40413247-40413269 ATGGGGAAACTGCTGTTCCATGG + Intronic
1024233374 7:47379695-47379717 AAGGTGAGACTGATGCACCAAGG - Intronic
1027188802 7:75986431-75986453 ATCAAGAAACTGATGACCAAGGG + Exonic
1027505589 7:79013877-79013899 ATGGAAAAACTAACAAACCAGGG - Intronic
1028198789 7:87936385-87936407 ATGGTAAAACTGAAGAAGCAGGG + Intronic
1030586758 7:111430546-111430568 ATGGAGAGTCTGATAAATCAAGG - Intronic
1032158195 7:129487948-129487970 ATGGAGAAACTGAAGCACTAAGG + Exonic
1032728764 7:134616784-134616806 AGGGAAAAACTGATGATGCAGGG + Intergenic
1032904952 7:136353862-136353884 ATGGAGAAGCAGCTGTACCAGGG + Intergenic
1033652675 7:143354478-143354500 TTGGAGAAGGTGAGGAACCAGGG + Exonic
1034026916 7:147715135-147715157 ATGCAGAAATTGATAAACCAAGG - Intronic
1036047284 8:5158011-5158033 GTGGGGAATCTGATGAAGCAGGG - Intergenic
1037085590 8:14845204-14845226 ATGGAAAAACTTATGACTCATGG + Intronic
1038072302 8:24030620-24030642 ATGGAGAAACTGATGACATAGGG + Intergenic
1038189656 8:25308370-25308392 ATGGAGAAACTGAGGCCCAAAGG + Intronic
1038668302 8:29560911-29560933 ATAGAAAAACTGAAGATCCAAGG + Intergenic
1039381960 8:37093841-37093863 ATGGAGAAACTAACGGTCCATGG - Intergenic
1041248472 8:55911788-55911810 ATTGAGAAACAGAGGAATCAAGG + Intronic
1041682538 8:60607714-60607736 ATGTAGATACTGCTGATCCAGGG + Intronic
1042276319 8:67008613-67008635 AAGGAGAATCTCTTGAACCAAGG + Intronic
1043482534 8:80667834-80667856 GTGGAGAAACTGAGGAACGGGGG - Intronic
1044803502 8:95981286-95981308 ATGGAGAGATTGATGAATCCTGG - Intergenic
1044845157 8:96373111-96373133 AGGGAGAAACTGATGAAAGTTGG - Intergenic
1045615641 8:103907301-103907323 TTGAAGAAACTGAAGAACCAAGG - Intronic
1046759887 8:118010043-118010065 ATGAAGACACTGATGGACAAAGG - Intronic
1049930055 9:447644-447666 ATGGAGAAACTGATGAACCATGG - Intronic
1050271814 9:3954212-3954234 TTGGAGAAACTGAGGCACCAGGG + Intronic
1050474618 9:6027657-6027679 ATGGAGAATCTCTTGAACCCGGG + Intergenic
1051049968 9:12920618-12920640 ATGGAAAAACTGACCAACTATGG - Intergenic
1052493182 9:29192812-29192834 ATGAACAAACTGCAGAACCATGG - Intergenic
1054331224 9:63757979-63758001 TTGGAGAAACTGATGACAAATGG + Intergenic
1054717791 9:68574285-68574307 ATGGGAAAACAAATGAACCAAGG + Intergenic
1054972843 9:71108517-71108539 ATGGAAAATCTCATTAACCAAGG - Intronic
1055577343 9:77673384-77673406 ATGAAGAAACTGAGGCTCCAAGG + Intergenic
1056993367 9:91431315-91431337 ATGAAGAAACTGAGGCATCAAGG - Intergenic
1057230232 9:93317428-93317450 ATGGAGAAACTGTGGCACCCTGG + Intronic
1058832959 9:108835801-108835823 ATGCAGTCACTGATGAACCCAGG + Intergenic
1060176824 9:121503355-121503377 ATGGAGAATCTGAGGAAGAAAGG - Intergenic
1060593473 9:124833967-124833989 ATGGAGAAACTGAGGCTCAAGGG - Intergenic
1060692056 9:125671603-125671625 AAGGGGAATGTGATGAACCAAGG - Intronic
1062175420 9:135159407-135159429 ATGGGGAAACTGAAGCCCCAAGG + Intergenic
1062370913 9:136238243-136238265 ACGGGGAAACTGATCAGCCAGGG + Intronic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1186250301 X:7658787-7658809 AGGGAGAAACTGATGGGCCCAGG + Intergenic
1188167142 X:26875428-26875450 ATGGAGATACTGCTGGACCTGGG + Intergenic
1192087809 X:68118200-68118222 ATGGAGAAAGTGGTGCACCTTGG + Intronic
1192201406 X:69068853-69068875 CTGGGGAAACTGAGGACCCAAGG - Intergenic
1194776846 X:97975882-97975904 CTGAAGAAGCTGAAGAACCAAGG - Intergenic
1194852098 X:98881957-98881979 ATGGAGAAACTGATGGAAGTAGG + Intergenic
1196280889 X:113822472-113822494 ATGAAAAAACTGATGAATCTAGG - Intergenic
1198377942 X:136058105-136058127 CTGGAGAATCTGATGGACCCAGG - Intergenic
1199535756 X:148901123-148901145 ATGAAGAAACTGATGCTCAAAGG + Intronic
1200037796 X:153344636-153344658 ATGGAAAGACTGATGAGCCCTGG + Intronic
1201770655 Y:17614388-17614410 AGGGAGCATCTGTTGAACCACGG - Intergenic
1201830900 Y:18291598-18291620 AGGGAGCATCTGTTGAACCACGG + Intergenic