ID: 1049936360

View in Genome Browser
Species Human (GRCh38)
Location 9:504733-504755
Sequence AGGTTGGGAGGAGCGGCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 194}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049936342_1049936360 27 Left 1049936342 9:504683-504705 CCGCCCTTCCCCGAGCTCCGGGT 0: 1
1: 0
2: 0
3: 23
4: 285
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936346_1049936360 19 Left 1049936346 9:504691-504713 CCCCGAGCTCCGGGTCCGCGGCG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936343_1049936360 24 Left 1049936343 9:504686-504708 CCCTTCCCCGAGCTCCGGGTCCG 0: 1
1: 0
2: 1
3: 14
4: 118
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936352_1049936360 4 Left 1049936352 9:504706-504728 CCGCGGCGGAGCGAGCGAGCGGC 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936350_1049936360 10 Left 1049936350 9:504700-504722 CCGGGTCCGCGGCGGAGCGAGCG 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936349_1049936360 17 Left 1049936349 9:504693-504715 CCGAGCTCCGGGTCCGCGGCGGA 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936338_1049936360 29 Left 1049936338 9:504681-504703 CCCCGCCCTTCCCCGAGCTCCGG 0: 1
1: 0
2: 0
3: 38
4: 346
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936347_1049936360 18 Left 1049936347 9:504692-504714 CCCGAGCTCCGGGTCCGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 159
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936340_1049936360 28 Left 1049936340 9:504682-504704 CCCGCCCTTCCCCGAGCTCCGGG 0: 1
1: 0
2: 4
3: 41
4: 467
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1049936344_1049936360 23 Left 1049936344 9:504687-504709 CCTTCCCCGAGCTCCGGGTCCGC 0: 1
1: 0
2: 0
3: 18
4: 163
Right 1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049936360 Original CRISPR AGGTTGGGAGGAGCGGCCGA AGG Exonic
900400668 1:2471683-2471705 AGGTCAGGTGGCGCGGCCGATGG + Intronic
900792842 1:4691244-4691266 AGGGAGGGAGGAGCACCCGAGGG - Intronic
903323569 1:22556541-22556563 TGGTGGGGAGGAGAGGCTGAAGG + Intergenic
904527741 1:31146808-31146830 AGGTTGGGTGGCGGGGCCGGGGG + Intergenic
906495687 1:46302701-46302723 AGGTTAGGAGGCCCGGCCTAAGG - Intronic
908186252 1:61655458-61655480 AGGCTGGGAGAAGGGGCCGTTGG + Intergenic
908780316 1:67685040-67685062 AGGTTGAGAGGAGCGGAAAAGGG - Exonic
912240597 1:107903894-107903916 GGGTTGAGAGGAGCTGCTGATGG - Intronic
912704753 1:111903752-111903774 AGGCAGGGAGGAGCAGCCCATGG - Intronic
917465340 1:175271141-175271163 AGGTAGGGAGGAGGGGACAAAGG - Intergenic
917880650 1:179332548-179332570 AGGAAGGGAGAAGCGGCAGAAGG - Intronic
918423560 1:184387020-184387042 AGCTTGCGAGGAGCGAGCGAGGG - Intergenic
919669680 1:200327465-200327487 AGGTTGGGAGGACCCACTGAAGG - Intergenic
919922671 1:202175755-202175777 AGGCTGGGAGGGGAGGCCCAGGG - Intergenic
922570045 1:226629254-226629276 AGGTGGGGAGGAGAGGTCGCAGG + Intergenic
922715757 1:227870576-227870598 ACGTTGGGAGGTGGGGCCCAAGG + Intergenic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
923661017 1:235957242-235957264 AGGCTGGGAGGAGGGGCCAGAGG + Intergenic
1064499153 10:15950054-15950076 TGGTTGGAAGGAAGGGCCGAAGG - Intergenic
1065343280 10:24724822-24724844 GGGTGGGAAGGAGAGGCCGAGGG - Intergenic
1065779982 10:29158224-29158246 AGGTTGGAAGGAGAGGCCCCTGG - Intergenic
1066502478 10:36007569-36007591 GGGTGGGGAGGAGTGGCTGAGGG + Intergenic
1069906633 10:71736035-71736057 AGGCTGGGAGGAGAGGCCAGTGG + Intronic
1073135270 10:101216788-101216810 TGGCTGGCAGGAGAGGCCGAAGG - Intergenic
1074435660 10:113432088-113432110 AGGTTAGGAGGGGCGGGAGAGGG + Intergenic
1074956546 10:118396496-118396518 AGGTTGGGTGGAGGAGCTGATGG + Intergenic
1075704859 10:124494548-124494570 AGGTGGGCAGGAGGGGACGAGGG + Intronic
1076546885 10:131251306-131251328 GGGCTGGGAGGAGGGGCCGGGGG - Intronic
1076618451 10:131771817-131771839 AGAGTGGGTGGAGCGGCAGACGG + Intergenic
1076999146 11:313897-313919 AGGGTGGGAGGAAAGGCTGAAGG - Exonic
1077081516 11:726522-726544 GGGGTGGGAGGTGCGGCCGAAGG + Intronic
1079101899 11:17547225-17547247 AGCCTGGGAGGAGGGGCTGAGGG + Intergenic
1081785680 11:45745232-45745254 AGGGTGGGTGGAGCAGCCAAGGG + Intergenic
1083161296 11:60855848-60855870 AGGTAAGGAGGAGTGGCCCAGGG - Exonic
1083241600 11:61392704-61392726 AGGTGGGAGGGAGCGACCGAAGG - Intronic
1083243818 11:61410090-61410112 AGGTAGGGAGGAGGGGCGGGTGG - Intronic
1083457224 11:62787130-62787152 AGGCTGGGAGGCGCTGCCGCGGG + Exonic
1084106772 11:66985600-66985622 AGGTGGTGAGGAGCGGGTGATGG - Intergenic
1085119175 11:73956323-73956345 AAGCTGGGAGGAGCTGCAGAGGG + Intronic
1085768945 11:79308082-79308104 AGGCTGGGTGGAGAGGCCGGAGG + Intronic
1085812092 11:79692769-79692791 AGGTTGGGAGGATAGGTGGAAGG + Intergenic
1086455489 11:86955560-86955582 AGGGAGGGAGGGGCGGCCGGAGG - Intergenic
1089170003 11:116505203-116505225 AGGTTGGGAGGAGCAGGGGCTGG - Intergenic
1090733199 11:129589422-129589444 AGGGAGGGAGGAGCAGCGGATGG + Intergenic
1091878878 12:3960392-3960414 AGGATGGGAGGAATGGCAGAAGG - Intergenic
1092810153 12:12265728-12265750 AGTTTGAGAAGAGCTGCCGACGG + Intronic
1093423207 12:18998680-18998702 AGGTTGGGAGGAGAGGGCAGGGG + Intergenic
1096016367 12:48279523-48279545 AGGTTGGAAAGAGAGGCAGAGGG - Intergenic
1096542269 12:52314478-52314500 AGGTGGGGAGGAGCCGCTGGTGG + Exonic
1096656801 12:53097370-53097392 GGGTGGGGAGGAGCGGAAGAAGG - Intergenic
1102112051 12:110372078-110372100 AGGTTGGAAGAGGCGGCTGAAGG - Intergenic
1102115995 12:110403423-110403445 AGGCGGGAAGGAGCGGCCGCCGG - Intronic
1106340202 13:28820107-28820129 AGGTTGGGCTGGGCGGCCGCCGG + Intergenic
1106830432 13:33575508-33575530 ATGTTGGGAGGTGGGGCCTATGG + Intergenic
1111940549 13:94602131-94602153 GGGCCGGGAGGAGCGGCCGGCGG - Intronic
1115769779 14:36657044-36657066 AGGAAGGGGGGAGCGGCCTAGGG - Intergenic
1115863170 14:37712329-37712351 AGGTTGGGAGGAGAGGGAGATGG - Intronic
1121410576 14:93745978-93746000 AGGATGGGGGCAGCGGCGGAGGG - Intronic
1122178241 14:99936765-99936787 AGGTTGGGAGGGGAGGAGGAGGG - Intronic
1122454135 14:101836365-101836387 AGGTCGGGAGTAGAGGCAGAAGG - Intronic
1122539625 14:102490703-102490725 AGGTTTGGAGGAGGAGCCCATGG - Intronic
1122848392 14:104513283-104513305 AGGGAGGGAGGGGCAGCCGAGGG + Intronic
1125603423 15:40927667-40927689 AGGTGGGGCGGGGCGGCAGATGG - Intergenic
1127259733 15:57319336-57319358 AGGTGGGGAGAAGCGGCTGACGG + Intergenic
1128072144 15:64804422-64804444 AGGATGGTAGGAGCTGCTGATGG + Intergenic
1129271540 15:74421742-74421764 AGGTTGGCAGGAGCGGGGGCTGG + Intronic
1129935103 15:79440655-79440677 TGGTGGGGAGGAGCGGGGGAAGG - Intronic
1131055492 15:89372079-89372101 AGGTGGGGGGGAGGGGCGGATGG + Intergenic
1131151581 15:90050506-90050528 AGGTTGGGTGGAGGGGTCCAGGG - Intronic
1131257588 15:90872106-90872128 GGGAGGGGAGGAGCGGCCGGGGG + Intronic
1132893240 16:2214801-2214823 CGGCTGCGAGGAGCGGCCGGCGG - Exonic
1132936483 16:2483838-2483860 AGGCTGGGAGCAGGGGCCGGGGG + Intronic
1133520290 16:6549548-6549570 AGGATGGGAGGAGGGGAGGAAGG + Intronic
1135547291 16:23374815-23374837 AGGTAGGGAGGAGCTGGCCAGGG + Intronic
1136094106 16:27941937-27941959 AGGCTGGAAGGAGAGGCAGATGG + Intronic
1137468207 16:48730497-48730519 AGGTGGGCAGGAGCCGCCTATGG - Intergenic
1139599942 16:67980404-67980426 AGCCTGGGAGGAGCAGGCGATGG + Exonic
1141856524 16:86684901-86684923 AGCTGGGGAGGACCGGCCCAGGG - Intergenic
1141891573 16:86929929-86929951 AGGGTGGGAGAAGGGGCAGAGGG - Intergenic
1142128340 16:88421125-88421147 GGGTTGGGAGCAGCGGCCAGGGG + Intergenic
1142139175 16:88465078-88465100 AGGCTGGGAGAAACGGCCAAGGG - Intronic
1142285312 16:89169294-89169316 GTGTTGGGAGGAGTGGCCAAGGG + Intergenic
1142322673 16:89394272-89394294 AGGTGTGGAGGAGAGGCGGACGG - Intronic
1142472145 17:170476-170498 AGGCTGGGAGGAGGGGCAGGGGG + Intronic
1146263057 17:31434032-31434054 AGGGTGCGAGGAGCTGCTGAAGG + Exonic
1146928446 17:36761571-36761593 GGGTGGGGAGGAGGGGACGAGGG - Intergenic
1147193812 17:38752001-38752023 AGCTTGGGAGGAGAGGACGCGGG + Intergenic
1147793023 17:43025144-43025166 GGGGTGGGAGGAGGGGCCGGGGG + Intergenic
1147904575 17:43814360-43814382 AGCTTGGGAGGAGGGGCAGAGGG + Exonic
1152218622 17:79048802-79048824 AGGTTGGTAGAAGCAGCCGAAGG + Exonic
1152573490 17:81130500-81130522 AGGCTGCGAGGAGGGGCCGAGGG - Intronic
1152593083 17:81223110-81223132 AGCGTGGGAGGAGCGGCGGATGG + Intergenic
1152608426 17:81304270-81304292 AGGTTGGGCGAGGCGGCCGCAGG + Intergenic
1152638503 17:81439895-81439917 AGGTGGGGAGAAGGGGCTGAGGG - Intronic
1152697781 17:81805195-81805217 AGGATGGGTGGAGCGGCCACTGG - Intronic
1152723060 17:81932224-81932246 AGGATTGGAGGAGCTGCTGAGGG - Intergenic
1157681923 18:49614040-49614062 AGGTGGGGAGGAGCTGAGGAAGG + Intergenic
1160474490 18:79170138-79170160 AGGTAGGGAGGAGCTGCAGCCGG + Intronic
1160754915 19:752006-752028 AGGCTGGGAGGAGCAACCCAGGG + Intronic
1160868983 19:1268476-1268498 ACGGTGGGAGGGGAGGCCGAGGG + Intronic
1161162063 19:2767244-2767266 AGGTTGGGAGGAGAGGACAGCGG - Intronic
1161208321 19:3053778-3053800 AGGTTGGGAGGGGGGACAGAGGG - Exonic
1161249123 19:3270969-3270991 AGGGAGGGAGGGGCGGCCGCGGG - Intronic
1161415726 19:4145432-4145454 AGGTGGGGAGGAGGGGAAGAGGG + Intergenic
1163167411 19:15507893-15507915 GGGTGGGGAGGAGTGGCGGAGGG + Intergenic
1164716241 19:30392329-30392351 AGGTTAGGAGCAGCCGCCAAAGG + Intronic
1165329872 19:35135429-35135451 AGGGTGGGAGGAGAGGCCCTGGG + Intronic
1165782041 19:38440660-38440682 AGGGTGGGAGGAGGGGCCTGTGG + Intronic
1168123672 19:54270998-54271020 AGGTGGGGAGGATCTGCCCAGGG - Intronic
1168178680 19:54644523-54644545 AGGTGGGGAGGATCTGCCCAGGG + Intronic
926679404 2:15652481-15652503 AGGATGGGAGGAGGGGCTGCAGG - Intergenic
927492573 2:23530293-23530315 AGGTTGGGAGGACAAGCCGTGGG - Intronic
928308837 2:30193486-30193508 AGGTGGGGAGGAGGGACCTAGGG - Intergenic
929075672 2:38077052-38077074 AGCGCGGGAGGAGCGGCCGCAGG - Intronic
929439367 2:41953227-41953249 AGATTGGGAGGGGCTGCAGAGGG + Exonic
929969900 2:46565055-46565077 AGGTGGGGAGCAGCTGCAGAAGG + Intronic
932566807 2:72916067-72916089 AGGTGGGGAGGGGCGGCCAGGGG - Intergenic
933051888 2:77611200-77611222 AGGTTGGAAGGAGCAGGGGAAGG - Intergenic
933702259 2:85263840-85263862 AGGTTCTGAGGAGCGGCTGGAGG + Intronic
935744762 2:106180829-106180851 AAGTTGGGAGGAGAGGAGGAAGG - Intronic
937988109 2:127647692-127647714 AGGTTGGCAGGAGAGGAGGAAGG - Intronic
938210953 2:129465363-129465385 GGGCTGGGAGGACCGGCTGAAGG - Intergenic
942193346 2:173493164-173493186 AGGTCAGAAGGTGCGGCCGAGGG + Intergenic
945956067 2:216087018-216087040 AGGGTGGGAGGAGAGGACGTGGG + Intronic
946687861 2:222290047-222290069 AGGTTGGGAGGAGGGGAAGGCGG - Intronic
947928169 2:233939179-233939201 AGGGTGGGAGCAGCGACCGCGGG + Intronic
948355410 2:237373594-237373616 AGTTGGGGAGGAGCGGAGGAAGG - Intronic
1169660197 20:7970813-7970835 AGGGTAGGTGGAGCGGACGAAGG - Intergenic
1172272731 20:33663640-33663662 AGATTGCGCGGAGCGGGCGAAGG + Exonic
1172978858 20:38926334-38926356 AGGCGGGGAGGTGCGGCCAATGG + Exonic
1173876987 20:46379341-46379363 ATGTTGGGAGGTGGGGCCGGTGG - Intronic
1175237981 20:57526313-57526335 AGGGTGGGAGGAGGGCCCGCAGG + Intergenic
1175492485 20:59388612-59388634 AGGTTGGCAGGAGCAGCTTAGGG + Intergenic
1175828821 20:61951096-61951118 AGGGTGGGAAGAGGGGCCCAGGG - Intergenic
1177157355 21:17512992-17513014 GGGCTGGGAGGAGGGGCGGAGGG + Exonic
1179958171 21:44752444-44752466 AGGCGGTGAGGAGCGGCCCAGGG - Intergenic
1180195479 21:46191137-46191159 CAGCTGGGAGAAGCGGCCGAGGG + Exonic
1184189914 22:42887646-42887668 AGGAGGGGAGGTGGGGCCGAGGG + Intronic
1184709385 22:46239599-46239621 GGCTTAGGAGAAGCGGCCGATGG + Exonic
951620128 3:24592372-24592394 AGGTTTGAAGGAGTGGCTGATGG - Intergenic
954423669 3:50432156-50432178 AGCTTGGGAGGAGCAGCCAAAGG - Intronic
956942310 3:74177816-74177838 AGCTTGGGAGGAGTGCCCTAAGG + Intergenic
961663818 3:128484259-128484281 AGGAGGGGAGGAGGGGCCCAGGG + Intronic
963733060 3:148991387-148991409 AGGGAGGGAGGAGGAGCCGAGGG + Exonic
968232956 3:197015161-197015183 AGGCGGGGAGGAGCGACCGCAGG - Intronic
968232974 3:197015213-197015235 GGGTGGGGAGGAGCGACCGCAGG - Intronic
968953201 4:3705335-3705357 AGGTTGGGAGGTGCAGGCTAGGG + Intergenic
969348983 4:6587197-6587219 AGGAAGGGAGGAGCGGTCGCTGG - Intronic
970542849 4:17096526-17096548 AGGTTGAGAGGAGTGGTCAAGGG - Intergenic
975919616 4:79369599-79369621 AGGTTGGGAGAAGTGGAGGATGG + Intergenic
976374115 4:84324865-84324887 GGGGTGGGGGGAGGGGCCGAGGG + Intergenic
977821320 4:101475537-101475559 AGCTTGGGAGGTGAGGCTGAAGG - Intronic
986704122 5:10441512-10441534 AAGTTTGGAGGAGCGGCCCCAGG + Exonic
990533880 5:56700970-56700992 AAGCTGGGAGGAGCTGCAGAAGG + Intergenic
998399232 5:141839504-141839526 AGGTGGGGAGGAGCTGGAGAGGG + Intergenic
999271998 5:150302237-150302259 GGCTGGGGCGGAGCGGCCGAGGG + Exonic
999470990 5:151855365-151855387 AGGTTGGGAAGAGAGGTGGAAGG - Intronic
1001038835 5:168317448-168317470 AGGATGGGAGGTGTGGCCCAGGG + Intronic
1001762750 5:174221766-174221788 TGGTTGGGAGGAGAGGCCTGTGG - Intronic
1002132999 5:177092740-177092762 AGACTGGTAGGAGAGGCCGATGG - Exonic
1003664831 6:8101377-8101399 AGCTAGGGAGTAGGGGCCGAAGG + Intronic
1007618438 6:43196483-43196505 GGTTTGGGAGGAGTGGCCCAAGG + Intronic
1008131127 6:47720961-47720983 AGGGTGGAAGGAGCAGCCCAGGG + Intronic
1010186606 6:73151417-73151439 AGGTTGGGAGGGTCTGCAGAAGG - Intronic
1012044478 6:94252642-94252664 AGGCAGGGAGGAACGGCTGAGGG - Intergenic
1013342841 6:109232112-109232134 ATGTTTGGAGGAGTGGCAGAAGG - Intergenic
1018112148 6:160546209-160546231 AGGGAGGGAAGAGGGGCCGAAGG + Intronic
1018816549 6:167336915-167336937 AGGTGGGGAGGAGCCCCCCAAGG - Intronic
1019336429 7:485068-485090 GGGCTGGGAGGAGAGGCCCAGGG - Intergenic
1019352717 7:562464-562486 TGGTTGGGAGGTGAGGCCGAGGG - Intronic
1019795271 7:3043894-3043916 AGGCTGGGAGGGGCGGGGGAGGG + Exonic
1019929887 7:4216348-4216370 AGAGTGGGAGCAGCGGCCGTGGG - Intronic
1020013308 7:4817861-4817883 AGGCTGGGGGGAGCTGCCCACGG + Intronic
1020875984 7:13694196-13694218 AGGTTGGGAGGAGGAGATGAGGG - Intergenic
1025940587 7:66073978-66074000 AGGTAGGGAGGAGAGGTGGAAGG - Intergenic
1029441889 7:100591316-100591338 AGGATGGGAGGAGGGGCTCAGGG + Intronic
1029503826 7:100950174-100950196 AGCTGGGGAGGAGCCGCCGGGGG - Intronic
1031989926 7:128190856-128190878 AGGATTGGAGGAGGGGCCGGAGG - Intergenic
1035241320 7:157531622-157531644 AGGGTGGGAGGAGAGGCCCAGGG - Intergenic
1035961918 8:4147251-4147273 AGGTGAGGAGGAGCCGCTGAAGG - Intronic
1036561701 8:9904443-9904465 AGGGAGGGAGGAGAGGCGGAGGG + Intergenic
1037581689 8:20249346-20249368 AGGTTGGGATGAGAAGCAGAGGG + Exonic
1037754554 8:21702668-21702690 AGGCAGGGAGGAGCTGCCGGGGG - Intronic
1041167119 8:55101865-55101887 GGGCCGGGAGGAGCGGCCAAGGG - Intergenic
1041687125 8:60653783-60653805 AGGGCTGGAGGAGCGGCCCAAGG - Intergenic
1042216322 8:66432413-66432435 GGGTGGGCAGGCGCGGCCGAGGG + Intronic
1047253068 8:123195091-123195113 AGGAAGGGAGGAACAGCCGAAGG + Intronic
1047475682 8:125226696-125226718 AGGTGGAGAGGAGAGGCAGAGGG + Intronic
1048986405 8:139737399-139737421 GGGTGGTGAGGAGCGGCCGAGGG - Intronic
1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG + Exonic
1051259569 9:15249705-15249727 AGGTTGGGGGGAGGGTCAGAGGG + Intronic
1057020436 9:91693267-91693289 AGTTTGGGTGGAGAGGCCAAGGG - Intronic
1057586265 9:96331511-96331533 AGGGTGGCAGGAGGGGCAGAGGG - Intronic
1058511667 9:105725273-105725295 AGGGTGGGAGGAGGAGCCAAGGG - Intronic
1061425998 9:130498807-130498829 AGGTTGGGAGGAGCAGCTAAGGG + Intronic
1061951840 9:133940577-133940599 AGGATGGGAGGAGTGGCCTGAGG - Intronic
1062406130 9:136397555-136397577 ATGTTGGGAGGAGAGGCTGTGGG + Intronic
1062408217 9:136408156-136408178 AGTGTGGGAGCAGGGGCCGAGGG - Intronic
1062688118 9:137826812-137826834 AGTTTGGGAGGTGCGGCCCTAGG - Intronic
1186378535 X:9033587-9033609 GTGTTGGGGGGAGGGGCCGAGGG - Intronic
1186743853 X:12545743-12545765 AGGCAGGGAGGAGGGGCAGATGG + Intronic
1188451062 X:30308667-30308689 GGCTCCGGAGGAGCGGCCGAGGG - Exonic
1190070179 X:47273064-47273086 ATGTTGGCAGGAGGGGCAGAGGG + Intergenic
1190714869 X:53094515-53094537 AGGGTGGGAGGTGGGGCCGCGGG - Intergenic
1192433368 X:71127298-71127320 AGGTTGGGAGGGTCAGCAGATGG - Intronic
1193893342 X:87079734-87079756 AGGGTGGGAGGAGGGGGGGAGGG - Intergenic
1195589140 X:106603681-106603703 AGGGTGGGAGGAGAGGTCAAGGG - Intergenic