ID: 1049936504

View in Genome Browser
Species Human (GRCh38)
Location 9:505185-505207
Sequence ACGGGGGACCCTCTCTGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049936500_1049936504 -7 Left 1049936500 9:505169-505191 CCTAGCCCGGGGCGGAACGGGGG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936498_1049936504 -6 Left 1049936498 9:505168-505190 CCCTAGCCCGGGGCGGAACGGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936483_1049936504 30 Left 1049936483 9:505132-505154 CCCGGCGCTCTGTCCCTCGGATG 0: 1
1: 0
2: 2
3: 12
4: 187
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936489_1049936504 7 Left 1049936489 9:505155-505177 CCTCTGGGCCCTTCCCTAGCCCG 0: 1
1: 0
2: 3
3: 21
4: 276
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936488_1049936504 16 Left 1049936488 9:505146-505168 CCTCGGATGCCTCTGGGCCCTTC 0: 1
1: 0
2: 0
3: 25
4: 209
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936484_1049936504 29 Left 1049936484 9:505133-505155 CCGGCGCTCTGTCCCTCGGATGC 0: 1
1: 0
2: 3
3: 12
4: 115
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936487_1049936504 17 Left 1049936487 9:505145-505167 CCCTCGGATGCCTCTGGGCCCTT 0: 1
1: 0
2: 0
3: 21
4: 156
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936495_1049936504 -2 Left 1049936495 9:505164-505186 CCTTCCCTAGCCCGGGGCGGAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data
1049936494_1049936504 -1 Left 1049936494 9:505163-505185 CCCTTCCCTAGCCCGGGGCGGAA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049936504 Original CRISPR ACGGGGGACCCTCTCTGAAG CGG Intronic
No off target data available for this crispr