ID: 1049936610

View in Genome Browser
Species Human (GRCh38)
Location 9:505556-505578
Sequence GTTCCACGGGACCCGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049936610_1049936618 11 Left 1049936610 9:505556-505578 CCTTCACCCGGGTCCCGTGGAAC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1049936618 9:505590-505612 ACTGTTCTTGGTGGCTCTTGCGG No data
1049936610_1049936617 2 Left 1049936610 9:505556-505578 CCTTCACCCGGGTCCCGTGGAAC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1049936617 9:505581-505603 TCAGAGGCAACTGTTCTTGGTGG No data
1049936610_1049936616 -1 Left 1049936610 9:505556-505578 CCTTCACCCGGGTCCCGTGGAAC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1049936616 9:505578-505600 CTTTCAGAGGCAACTGTTCTTGG No data
1049936610_1049936619 12 Left 1049936610 9:505556-505578 CCTTCACCCGGGTCCCGTGGAAC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049936610 Original CRISPR GTTCCACGGGACCCGGGTGA AGG (reversed) Intronic
914753221 1:150549534-150549556 GTCTAACGGGACCCGGGAGAGGG - Intronic
1063678901 10:8167177-8167199 ATTCCACGGTAACTGGGTGAAGG + Intergenic
1064568318 10:16666701-16666723 GTGCCACCGCACCCGGCTGATGG - Intronic
1077028146 11:450781-450803 GCTCCCCGGGACCCGGGGGGCGG - Intronic
1077483029 11:2825398-2825420 GTGCCAGGGGCCCCGGGTGCTGG + Intronic
1091127077 11:133110008-133110030 GTTCGACAGGACTTGGGTGAAGG + Intronic
1092226198 12:6749792-6749814 TGTCCACGGGAACCGGGTTAGGG + Intronic
1096911545 12:54989467-54989489 TTTCCATGGGAGCAGGGTGAGGG + Intergenic
1101902905 12:108804512-108804534 GAGCTACAGGACCCGGGTGAGGG + Intronic
1102646164 12:114405350-114405372 GCTCCCCGGGACCCTGGCGAGGG - Intronic
1110759419 13:79214782-79214804 GTGCCACTACACCCGGGTGATGG + Intergenic
1120842385 14:89097279-89097301 GTTCCACCCGAGCCAGGTGAAGG + Intergenic
1123468541 15:20533680-20533702 GTTGCAGGAGACCCGGTTGAGGG - Intronic
1123649573 15:22467382-22467404 GTTGCAGGAGACCCGGTTGAGGG + Intronic
1123728859 15:23128891-23128913 GTTGCAGGAGACCCGGTTGAGGG - Intronic
1123747023 15:23326356-23326378 GTTGCAGGAGACCCGGTTGAGGG - Intergenic
1124279292 15:28349672-28349694 GTTGCAGGAGACCCGGTTGAGGG - Intergenic
1124303406 15:28561936-28561958 GTTGCAGGAGACCCGGTTGAGGG + Intergenic
1128081659 15:64860763-64860785 GTTCCACGGGAGAGGGATGATGG + Intronic
1139418410 16:66832528-66832550 GTTCCATGGGAGCTGGGTAAGGG - Intronic
1140322527 16:73967038-73967060 GTCCCCCGGGACCCTGGTGGTGG - Intergenic
1148638825 17:49169661-49169683 CTTGAACTGGACCCGGGTGAGGG - Exonic
1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG + Exonic
1152754931 17:82083255-82083277 GTTCCATGGGGCCCAGGTGGAGG - Exonic
1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG + Intergenic
1157825307 18:50806839-50806861 TTTCCAAGAGACCTGGGTGATGG + Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1167574212 19:50309928-50309950 GTTGCAGGGGACCCAGGTGGGGG - Exonic
925546025 2:5017677-5017699 ATTCCATGGGACCTGTGTGAAGG + Intergenic
925838297 2:7966609-7966631 GGTCCACAGGACCAGGGAGATGG + Intergenic
925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG + Intergenic
939204021 2:139076737-139076759 GTTCCATGGGACCAGGTAGAGGG + Intergenic
946001783 2:216488527-216488549 TGTCCACAGGGCCCGGGTGAGGG - Intergenic
948424075 2:237876873-237876895 GTTCCACGGGTACCTGGGGATGG - Intronic
1171284040 20:23923328-23923350 GTGCCACCGGACCCTGGTCAGGG + Intergenic
1171749047 20:29029437-29029459 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1176316136 21:5246267-5246289 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1176546740 21:8205544-8205566 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176554635 21:8249734-8249756 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176565691 21:8388591-8388613 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176573556 21:8432759-8432781 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1178753023 21:35322229-35322251 GTTACAAGTGACCCGGCTGAAGG - Intronic
1180393940 22:12312193-12312215 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1180405807 22:12552557-12552579 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1203251605 22_KI270733v1_random:121810-121832 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1203259655 22_KI270733v1_random:166892-166914 GCTCCCCGGCACCCGGGGGACGG - Intergenic
950056204 3:10026672-10026694 GTTCATCGGGAAGCGGGTGAGGG - Intronic
953570407 3:44067048-44067070 GCACCAGGAGACCCGGGTGAAGG + Intergenic
954841510 3:53515695-53515717 GCTCCTCAGGACCCAGGTGATGG + Intronic
968563456 4:1296819-1296841 GTGTCACGGGAGCCGAGTGATGG - Intronic
968878711 4:3287864-3287886 GTCCCACGGGGCCTGGGTGGGGG + Intergenic
970235970 4:13958248-13958270 GTTTCACGGGACTGGGATGAGGG + Intergenic
975191833 4:71472955-71472977 GTGCCACCTGACCCAGGTGAGGG + Exonic
994051325 5:95365776-95365798 GTTCCGTGGGAGCTGGGTGAGGG - Intergenic
1017514381 6:155142551-155142573 GGTCCTCGGGCCCCGGGTCATGG + Intronic
1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG + Intronic
1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG + Intergenic
1022540897 7:31134687-31134709 GCTCCACGGGCCCAGGGCGAGGG + Intergenic
1032292095 7:130597733-130597755 GTTCCAGGGGAGCCTTGTGAAGG + Intronic
1039446301 8:37635905-37635927 GTCCCACAGAACCCGGATGAAGG - Intergenic
1049743846 8:144254734-144254756 GGTCCACGGCACCCAGGTGGCGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1053465752 9:38307138-38307160 GTTTCACCGGACTCGGGTGTTGG + Intergenic
1054764987 9:69035850-69035872 CGGCCGCGGGACCCGGGTGAGGG - Exonic
1058450144 9:105088910-105088932 TTTCCAAGGGAGCCAGGTGAAGG - Intergenic
1058725229 9:107796826-107796848 ATTCCAAGGGACCCAGGTGGAGG - Intergenic
1058880069 9:109278173-109278195 CGTCCACCGGACCCGGGAGAAGG - Intronic
1062190813 9:135246985-135247007 GCTCCACAGGCCTCGGGTGATGG + Intergenic
1203468007 Un_GL000220v1:104961-104983 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1203475828 Un_GL000220v1:148933-148955 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1191900487 X:66035127-66035149 GTTCTAAGGGTCCCTGGTGAGGG - Intronic
1200003444 X:153073310-153073332 GTTCCACGGGCCCCCAGTGCCGG - Exonic
1200004279 X:153076699-153076721 GTTCCACGGGCCCCCAGTGCCGG + Intergenic
1200231437 X:154445737-154445759 GTGGCCCGGGGCCCGGGTGAGGG - Intronic