ID: 1049936616

View in Genome Browser
Species Human (GRCh38)
Location 9:505578-505600
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049936610_1049936616 -1 Left 1049936610 9:505556-505578 CCTTCACCCGGGTCCCGTGGAAC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1049936616 9:505578-505600 CTTTCAGAGGCAACTGTTCTTGG No data
1049936611_1049936616 -7 Left 1049936611 9:505562-505584 CCCGGGTCCCGTGGAACTTTCAG 0: 1
1: 0
2: 2
3: 11
4: 116
Right 1049936616 9:505578-505600 CTTTCAGAGGCAACTGTTCTTGG No data
1049936604_1049936616 23 Left 1049936604 9:505532-505554 CCACGGCTCCTTGACCGTTCATC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1049936616 9:505578-505600 CTTTCAGAGGCAACTGTTCTTGG No data
1049936608_1049936616 9 Left 1049936608 9:505546-505568 CCGTTCATCTCCTTCACCCGGGT 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1049936616 9:505578-505600 CTTTCAGAGGCAACTGTTCTTGG No data
1049936605_1049936616 15 Left 1049936605 9:505540-505562 CCTTGACCGTTCATCTCCTTCAC 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1049936616 9:505578-505600 CTTTCAGAGGCAACTGTTCTTGG No data
1049936612_1049936616 -8 Left 1049936612 9:505563-505585 CCGGGTCCCGTGGAACTTTCAGA 0: 1
1: 0
2: 1
3: 4
4: 106
Right 1049936616 9:505578-505600 CTTTCAGAGGCAACTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr