ID: 1049936619

View in Genome Browser
Species Human (GRCh38)
Location 9:505591-505613
Sequence CTGTTCTTGGTGGCTCTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049936605_1049936619 28 Left 1049936605 9:505540-505562 CCTTGACCGTTCATCTCCTTCAC 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data
1049936614_1049936619 -1 Left 1049936614 9:505569-505591 CCCGTGGAACTTTCAGAGGCAAC 0: 1
1: 0
2: 1
3: 20
4: 147
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data
1049936615_1049936619 -2 Left 1049936615 9:505570-505592 CCGTGGAACTTTCAGAGGCAACT 0: 1
1: 0
2: 2
3: 22
4: 194
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data
1049936612_1049936619 5 Left 1049936612 9:505563-505585 CCGGGTCCCGTGGAACTTTCAGA 0: 1
1: 0
2: 1
3: 4
4: 106
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data
1049936611_1049936619 6 Left 1049936611 9:505562-505584 CCCGGGTCCCGTGGAACTTTCAG 0: 1
1: 0
2: 2
3: 11
4: 116
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data
1049936610_1049936619 12 Left 1049936610 9:505556-505578 CCTTCACCCGGGTCCCGTGGAAC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data
1049936608_1049936619 22 Left 1049936608 9:505546-505568 CCGTTCATCTCCTTCACCCGGGT 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1049936619 9:505591-505613 CTGTTCTTGGTGGCTCTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049936619 Original CRISPR CTGTTCTTGGTGGCTCTTGC GGG Intronic
No off target data available for this crispr