ID: 1049944465

View in Genome Browser
Species Human (GRCh38)
Location 9:580808-580830
Sequence GAGCACCGCCCCCTGCTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1647
Summary {0: 2, 1: 101, 2: 490, 3: 528, 4: 526}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049944465_1049944481 30 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944481 9:580861-580883 ACGGCATCTGGGGGAGGCTCCGG No data
1049944465_1049944477 21 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944477 9:580852-580874 CTGGAGCCCACGGCATCTGGGGG No data
1049944465_1049944470 -8 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944470 9:580823-580845 CGGTGCTCGTTGGGGAGGCTTGG No data
1049944465_1049944473 11 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944473 9:580842-580864 TTGGGCTGCGCTGGAGCCCACGG No data
1049944465_1049944478 24 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944478 9:580855-580877 GAGCCCACGGCATCTGGGGGAGG No data
1049944465_1049944475 19 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944475 9:580850-580872 CGCTGGAGCCCACGGCATCTGGG No data
1049944465_1049944476 20 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944476 9:580851-580873 GCTGGAGCCCACGGCATCTGGGG No data
1049944465_1049944472 2 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944472 9:580833-580855 TGGGGAGGCTTGGGCTGCGCTGG 0: 3
1: 24
2: 119
3: 394
4: 971
1049944465_1049944471 -7 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944471 9:580824-580846 GGTGCTCGTTGGGGAGGCTTGGG 0: 13
1: 61
2: 272
3: 457
4: 610
1049944465_1049944474 18 Left 1049944465 9:580808-580830 CCGCGGAGCAGGGGGCGGTGCTC 0: 2
1: 101
2: 490
3: 528
4: 526
Right 1049944474 9:580849-580871 GCGCTGGAGCCCACGGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049944465 Original CRISPR GAGCACCGCCCCCTGCTCCG CGG (reversed) Intronic
900134149 1:1107085-1107107 GGGCACCACCCCCTGCTCCGCGG + Intronic
900787774 1:4659480-4659502 CACCACCACTCCCTGCTCCGAGG - Intronic
901045934 1:6395812-6395834 GAGCACCGCCCCCTGCTCCACGG - Intergenic
901601423 1:10426397-10426419 GAGCGTGGCCCCCTGCTCCACGG - Intergenic
901783391 1:11609038-11609060 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
901814305 1:11785159-11785181 GCGCACCGCCGACTGCACCGAGG - Exonic
901879167 1:12184235-12184257 GGGCCCAGCCCCCTGCTCCTGGG + Intronic
902033491 1:13439569-13439591 GAGCGCGGCCCCCTGCTCCACGG + Intergenic
902100378 1:13983201-13983223 GAGCGCCACCCCTTGCTCCACGG - Intergenic
902516466 1:16992259-16992281 GAGCCCTGCCACCAGCTCCGGGG + Exonic
902963916 1:19984529-19984551 GAGCGCCATCCCCTGCTCCATGG - Intergenic
903523894 1:23977647-23977669 GAGCACTGCCTGCTACTCCGTGG + Intronic
904238846 1:29131182-29131204 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
905345745 1:37309894-37309916 GTGAACCGCCCCCTGCCCCGAGG + Intergenic
905375680 1:37518574-37518596 GAGCACCACCCCCTACTCCACGG + Intergenic
906083085 1:43107401-43107423 GAGCACTGCCCCCCACTCCATGG - Intergenic
906108823 1:43310031-43310053 GAGCACCCCCACCTGCTCTAAGG + Intronic
906563465 1:46778556-46778578 GAGCACCGCCCCCTGCTCCACGG - Intronic
906877665 1:49556746-49556768 GGACCTCGCCCCCTGCTCCGAGG - Intronic
907102189 1:51847416-51847438 GAGCGCCGCCCCCTGCTCCACGG - Intronic
907759460 1:57343488-57343510 GAGCGCAGCCCCCTGCTCCATGG - Intronic
907889544 1:58623753-58623775 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
907980100 1:59472407-59472429 GAGCGCCGCCCCCTGCTCCACGG + Intronic
908027703 1:59969703-59969725 AAGCGCCGCCCCCTGCTCCACGG - Intergenic
908301166 1:62761853-62761875 GGGCACGGCCCCCTGCTCCATGG + Intergenic
908888640 1:68818034-68818056 GAGCGCCACCCCCTGCTCCACGG + Intergenic
909317980 1:74247938-74247960 GGGCACCACCCCCTGCTCCACGG - Intronic
909335285 1:74465580-74465602 GGGCACTGCCCCCTGCTTCACGG + Intronic
909608686 1:77531792-77531814 GAGCGCAGCCCCCTGCTCCACGG - Intronic
909820444 1:80053532-80053554 GAGCGCCGCCACCTGCTCCATGG - Intergenic
909904515 1:81178645-81178667 GAGCACCACCCCCTGCTCCACGG - Intergenic
910034719 1:82776820-82776842 GAGCACCACCCCCTGCTCCACGG - Intergenic
910550344 1:88467393-88467415 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
910609706 1:89128079-89128101 AAGCACCACCCCCTGCTCCATGG - Intronic
910693097 1:89984700-89984722 GAGCGCAGCCCCCTGCTCTATGG - Intergenic
911001494 1:93170551-93170573 GAGCGCCACTCCCTGCTCCACGG + Intronic
911205971 1:95091689-95091711 GAGCGCCGCCTCTTGCTCCACGG + Intergenic
911259548 1:95669666-95669688 GAGTGCCACCCCCTGCTCCACGG - Intergenic
911305185 1:96224376-96224398 GAGCACCACCCCCTGCTCCCCGG - Intergenic
911839197 1:102660050-102660072 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
911853996 1:102854098-102854120 GGGCGCCGCCCCCTGCTCCAGGG + Intergenic
911954448 1:104217482-104217504 GAGCACCACCCCCTACTCCATGG - Intergenic
912058073 1:105631273-105631295 TAGCACCACCCCCTGCTCCAGGG - Intergenic
912166207 1:107045091-107045113 GAGCGCCGCCCCCTGCTTCAGGG + Intergenic
912312828 1:108640907-108640929 GAGCACCACCCCCTACTCCACGG - Intronic
912315980 1:108667798-108667820 GAGCACCGCCCCTTGCTCCACGG + Intergenic
912414295 1:109497711-109497733 GAACACCTGCCCCTGCTCCTGGG - Intronic
912449123 1:109758769-109758791 GAGTCCCACCCCCTGCTCCCTGG + Intronic
912538706 1:110396367-110396389 GAGCACCGCCCCCTGCTCCACGG - Intergenic
912819322 1:112854551-112854573 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
913161013 1:116146592-116146614 GAGTGCCGCCCCCTGCTCCATGG - Intergenic
913469045 1:119171827-119171849 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
913470234 1:119179346-119179368 GAGCACCACCCTCTGCTCCATGG + Intergenic
913692064 1:121289142-121289164 GAGCACCACCCCCTGCTCCATGG - Intronic
913987143 1:143575377-143575399 GAGCGCCGCCTCCTGCTCCATGG + Intergenic
914145494 1:144990972-144990994 GAGCACCACCCCCTGCTCCATGG + Intronic
914203379 1:145505908-145505930 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
914438389 1:147680804-147680826 GAGTGCCGCCCCCTGCTCCATGG - Intergenic
914482501 1:148079062-148079084 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
914928110 1:151906459-151906481 GAGTGCTGCCCCCTGCTCCACGG + Intronic
915104172 1:153522099-153522121 GAGCGCCACCCCCTGCTCCACGG + Intergenic
915260112 1:154671084-154671106 GAGCACCGCCCCCTGCTCCATGG + Intergenic
915261282 1:154678371-154678393 GAGCACCGCCCCCTGCTCCATGG + Intergenic
915666057 1:157446321-157446343 GAGTGCAGCCCCCTGCTCCATGG - Intergenic
915668337 1:157465330-157465352 TAGCACCTCCCCCTGCCCCTTGG + Intergenic
915764440 1:158349027-158349049 GAGCGCAGCCCCCTGCTCCACGG - Intergenic
915865502 1:159494646-159494668 GAGTGCCGCCCCCTGCTCCATGG - Intergenic
916115084 1:161479303-161479325 GGGCACCGCCCCCTGCTCCATGG + Intergenic
916219917 1:162433474-162433496 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
916910064 1:169337113-169337135 AAGCGCCGCCCCCTGCTCCATGG - Intronic
916940112 1:169668333-169668355 GAGCGCTGCCCCCTGCTCCACGG + Intronic
916960332 1:169882432-169882454 CAGCGCCGCCCCCTGCTCCACGG + Intronic
917093943 1:171381722-171381744 AGGCGCCGCCCCCTGCTCCGTGG - Intergenic
917348820 1:174056447-174056469 CAGAGCCGCCCCCTGCTCCACGG - Intergenic
917406391 1:174711727-174711749 TGGCACTGCCCCCTACTCCGGGG + Intronic
917578501 1:176349305-176349327 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
918100463 1:181368638-181368660 CAGCACTGCCCCCTCCTCCCTGG - Intergenic
918511970 1:185321753-185321775 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
918659714 1:187073854-187073876 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
918708990 1:187703942-187703964 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
918720882 1:187850524-187850546 GAGCGCCTCCCCCTGCTCCACGG + Intergenic
918732257 1:188013359-188013381 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
918790020 1:188813345-188813367 GAGCGTGGCCCCCTGCTCCAAGG + Intergenic
918793222 1:188857978-188858000 AAGCACTGACCCCTGCTCCCAGG + Intergenic
918853161 1:189718337-189718359 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
918993934 1:191732093-191732115 GAGCGCCGCCCCCTGCTCAACGG + Intergenic
919070667 1:192751413-192751435 GGCCACTGCCCCCTGCTCCCTGG + Intergenic
919167903 1:193918950-193918972 GAGCACCACCCCCTGCTCCGCGG - Intergenic
919174517 1:194002163-194002185 GAGCGCCACCCCCTGCTCCATGG + Intergenic
919201302 1:194358308-194358330 GAGCGCCGCCACCTGCTCCACGG - Intergenic
919297726 1:195722952-195722974 GAGCACCACCCCCTGCTCCACGG - Intergenic
919419725 1:197355433-197355455 GAGCACCACCCCCTGCTCCGCGG - Intronic
919630993 1:199959942-199959964 AAGCTCCGCCCCCTGCTTCACGG + Intergenic
919892013 1:201982600-201982622 GAGCCCCGCCCCGAGCGCCGCGG - Intronic
920150278 1:203900561-203900583 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
920479385 1:206307490-206307512 GAGCACCACCCCCTGCTCCATGG - Intronic
920479505 1:206307899-206307921 CAGCACCCCCCCCTGCACTGTGG - Intronic
920731321 1:208488476-208488498 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
920756729 1:208740000-208740022 GAGCGCCACCCCCTGCTCCAGGG + Intergenic
920878405 1:209858687-209858709 GAGCTCCGGCCCCTGCTCCAGGG - Intergenic
920881982 1:209888989-209889011 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
920883101 1:209898838-209898860 GAGCACCAACCCCTGCTCCACGG - Intergenic
921094356 1:211874302-211874324 GAGCGCCGCCCCCTGCTCTGTGG - Intergenic
921096306 1:211889733-211889755 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
921396331 1:214673185-214673207 CAGCGCCACCCCCTGCTCCACGG - Intergenic
921801859 1:219410974-219410996 GAGCGCCACCCCCTGCTCCATGG + Intergenic
921897143 1:220412754-220412776 GAGCACCACCCCCTGCTCCACGG + Intergenic
921903783 1:220475707-220475729 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
922056876 1:222050068-222050090 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
922166089 1:223117000-223117022 GGGCGCCGCCCCCTGCTCCACGG - Intronic
922306929 1:224352557-224352579 GAGCGCCGCTCCCTGCTCCACGG - Intergenic
922423261 1:225473029-225473051 GAGCACCACCCCCTGCTCCACGG + Intergenic
922604088 1:226878342-226878364 GAGCACCGCACCCAGCCCCAGGG + Intronic
922855844 1:228774026-228774048 GAGCGGCGCCCCCTGCTCCACGG + Intergenic
923157185 1:231289513-231289535 GAGCGCCACCCTCTGCTCCATGG - Intergenic
923172561 1:231430855-231430877 GAGCCCCACCCCCTGCTCCAAGG - Intergenic
923324763 1:232871482-232871504 GAGCACCACCCCCTGCTCCACGG - Intergenic
923623191 1:235594470-235594492 AATCACCGCCCCCTGCTCCATGG - Intronic
923810473 1:237309667-237309689 AAGCGCCGCCCCCTGCTCCATGG - Intronic
924034745 1:239924803-239924825 GGGCACTGCCCCCTGCTCCGTGG - Intergenic
924117572 1:240762811-240762833 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
924219186 1:241855618-241855640 GAGCACCACCCCCTGCTCCACGG - Intronic
924313726 1:242774407-242774429 GGGCGCCACCCCCTGCTCCATGG - Intergenic
924624264 1:245686712-245686734 CAGCACGGCCCCCGTCTCCGAGG + Exonic
1063148898 10:3319852-3319874 GAGCGCTGCCCACTGCTCCACGG - Intergenic
1063300344 10:4844952-4844974 GAGCACCGCCCCCTGCTCCATGG - Intronic
1063318676 10:5032557-5032579 GAGCACCACCCCCTGCTCCACGG - Intronic
1063321011 10:5053183-5053205 GAGCGCTGCCCCCTGCTCCACGG - Intronic
1063664111 10:8051561-8051583 GAGCTCCGCCGGCTGCTCCTTGG + Intergenic
1063769748 10:9183671-9183693 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1063848758 10:10161215-10161237 GGGCACTGCCCCCTGCTCAGTGG + Intergenic
1064197840 10:13259928-13259950 GAGCACCACCCCCTGCTCCACGG + Intergenic
1064461074 10:15535259-15535281 GCGCACCGCCCCCTGCTCCACGG + Intronic
1065441386 10:25756320-25756342 GAGCGCCACCCCCTGCTCCAGGG + Intergenic
1065743226 10:28815712-28815734 GAGCGCCACTCCCTGCTCCACGG - Intergenic
1065895933 10:30163134-30163156 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1065965795 10:30769462-30769484 AGGCACTGCCCCCTGCTCCATGG - Intergenic
1065981522 10:30902846-30902868 GAGCACCACCCGCTGCTGCACGG - Intronic
1065983800 10:30930093-30930115 GGGCACCGCCCCCTGCTCTGCGG - Intronic
1066186354 10:33013614-33013636 GAGCACCACCCCCTACTCCACGG + Intergenic
1066190319 10:33049548-33049570 GAGCGCCACCACCTGCTCCAGGG + Intergenic
1066234096 10:33468355-33468377 GAGCACCACCCCCTGCTCCACGG + Intergenic
1066235410 10:33480506-33480528 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1066293668 10:34035709-34035731 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1066296144 10:34055837-34055859 GAGTGCCGCCCCCTGCTCCAGGG + Intergenic
1066544196 10:36482036-36482058 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1066567348 10:36734657-36734679 GAGCGCCAACCCCTGCTCCAAGG - Intergenic
1066575523 10:36820254-36820276 GAGTGCCACCCCCTGCTCCGTGG + Intergenic
1066615015 10:37285206-37285228 GGGCACCGCACCCTGCTCCACGG - Intronic
1066660928 10:37737651-37737673 GAGCGCTGCCCCCTGCTCCAAGG + Intergenic
1067131925 10:43573397-43573419 GGGCACAGCCCACTGCTCTGAGG + Intronic
1067363243 10:45601063-45601085 CAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1068211377 10:53924501-53924523 GAGCACCACCCCCTGCTCTGTGG + Intronic
1068374075 10:56155445-56155467 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1068460410 10:57321798-57321820 GAGCGCCGCCTCTTGCTCCACGG + Intergenic
1068863220 10:61867966-61867988 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1068978191 10:63033911-63033933 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1069186474 10:65429446-65429468 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1069766195 10:70861965-70861987 GAGCGCCACTCCCTGCTCCACGG + Intronic
1069988730 10:72300925-72300947 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1070172775 10:73944925-73944947 GAGCACTGCCCCCTGCTCTGCGG + Intergenic
1070564046 10:77590319-77590341 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1070592715 10:77812010-77812032 GAGCCGCGCCTGCTGCTCCGTGG + Exonic
1070942517 10:80359535-80359557 GAGCGCCACCCACTGCTCCGCGG - Intronic
1070968358 10:80543536-80543558 GAGCGCCACCCCCTGCTCCACGG + Intronic
1070999190 10:80814477-80814499 AAGTGCCGCCCCCTGCTCCACGG + Intergenic
1071003809 10:80859576-80859598 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1071037429 10:81264952-81264974 GAGCACCACCCCCTGCTCCACGG - Intergenic
1071055734 10:81506095-81506117 GAGTGCCGCCCCCTGCTCCATGG + Intergenic
1071078766 10:81784540-81784562 GAGCGCCGCCCCCTGCTTCACGG + Intergenic
1071332229 10:84571519-84571541 GAGCGCCGCCCCCTCCTCCAGGG + Intergenic
1071388056 10:85141722-85141744 GAGTGCTGCCCCCTGCTCCATGG + Intergenic
1071610958 10:87031024-87031046 GGGTGCCACCCCCTGCTCCGTGG - Intergenic
1071797035 10:89018692-89018714 GATCACCGCCCCCTGCTCTAAGG - Intergenic
1071900959 10:90119867-90119889 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1071963734 10:90832213-90832235 GAGTGCCACCCCCTGCTCCACGG - Intronic
1072016859 10:91356524-91356546 GATCACAGCTCCCTGCACCGTGG + Intergenic
1072341794 10:94459532-94459554 GGGCACCGCCGCCTGCTCCATGG - Intronic
1072611672 10:97021217-97021239 GAGCACAGCCTCCTGCTGCTGGG - Intronic
1073043213 10:100621424-100621446 GAGCGCCGCCCCCTCCTCAAAGG - Intergenic
1073532570 10:104245495-104245517 CAGCACTGCCCACTGCTCCAGGG + Intronic
1073789722 10:106928143-106928165 GAGCGCCGCCGCCTGCTCCACGG - Intronic
1073878346 10:107950859-107950881 AAGCACAGCCCGCTGCTCCAGGG + Intergenic
1074098185 10:110331788-110331810 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1074996292 10:118760185-118760207 GAGCACCGCTCTCTGCTCCACGG - Intergenic
1075255673 10:120924147-120924169 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
1075269329 10:121035377-121035399 GAGCACCACCCCCTGCTCCATGG - Intergenic
1075375972 10:121978427-121978449 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1075537472 10:123283391-123283413 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
1076261607 10:129071390-129071412 GAGTGCCACCCCCTGCTCCAGGG - Intergenic
1076374206 10:129972743-129972765 GAGGAGCGCACCCGGCTCCGGGG + Intergenic
1076716992 10:132371225-132371247 GAGCACCCCCCCATGCACCCGGG + Intronic
1076773663 10:132680975-132680997 GAGCTCCGCCCCCTGCTCCAGGG + Intronic
1076796485 10:132800983-132801005 GAGCTCCGCCCCCTGCTCCAGGG - Intergenic
1076876408 10:133218346-133218368 GAGTGCCGCCCCCTCCTCCGGGG - Intronic
1076900831 10:133336562-133336584 GACCACCGCCCTCGGGTCCGCGG + Intronic
1077603277 11:3589002-3589024 AAGCACCGCCCCCTGCTCCACGG + Intergenic
1077764641 11:5144718-5144740 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1077778171 11:5294481-5294503 GAGCGCCGCCCCCTGCTCCAGGG - Intronic
1077805815 11:5590201-5590223 GAGTGCCACCCCCTGCTCCAGGG + Intronic
1077815649 11:5683226-5683248 GAGCACCGCCCCCTGCTCCACGG + Intronic
1078251849 11:9623073-9623095 GAGCGCCACCCTCTGCTCCACGG - Intergenic
1078301148 11:10133342-10133364 AAGCACCACCCCCTGCTCCACGG - Intronic
1078743643 11:14091365-14091387 GAGCACCACCCCCTGCTCCACGG - Intronic
1078795871 11:14591386-14591408 GAGTGCCGCCCCCTGCTCCAGGG + Intronic
1078891387 11:15561245-15561267 GACCGCCGCCCCCTGCTCCCCGG + Intergenic
1079101427 11:17544407-17544429 AGGCCCCGCCCCCAGCTCCGAGG - Intronic
1079190939 11:18276174-18276196 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1079555378 11:21753180-21753202 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1079726172 11:23883469-23883491 AAGCACCACCCCCTGCTACACGG - Intergenic
1079767726 11:24416038-24416060 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1080105976 11:28512371-28512393 GAGCGCTGCTCCCTGCTCCACGG - Intergenic
1080138882 11:28890931-28890953 GAGCGCTGCCCGCTGCTCCATGG + Intergenic
1080195149 11:29600186-29600208 GAGCACCACCCCCTGCTCCACGG - Intergenic
1080204478 11:29712977-29712999 GAGCGCAGCTCCCTGCTCCATGG + Intergenic
1080557643 11:33431782-33431804 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1081115302 11:39192670-39192692 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1081125110 11:39312154-39312176 GAGCGCCACCCCCTGCCCCATGG + Intergenic
1081136109 11:39442123-39442145 GAGTGCTGCCCCCTGCTCCGTGG - Intergenic
1081324419 11:41728129-41728151 GAGCACCATCCTCTGCTCCATGG - Intergenic
1081329659 11:41788263-41788285 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1081420947 11:42874235-42874257 GAGCCCCGCCCCCTGCTCCATGG + Intergenic
1081705637 11:45180806-45180828 GCGCGCCGCCCCCTGCCCCGTGG - Intronic
1082272170 11:50183596-50183618 GAGCGCTGCACCCTGCTCCATGG + Intergenic
1082698710 11:56401958-56401980 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1082734968 11:56845514-56845536 GAGCACCGCCCCCTGCTCTAAGG + Intergenic
1084024702 11:66440816-66440838 GAGCACCACCCCCTGCTCCACGG - Intronic
1084107461 11:66989115-66989137 GAGCACCACCCCCTGCTCCAAGG + Intergenic
1084186692 11:67476375-67476397 GAGCGACGCCCCCTGCTCCAGGG + Intergenic
1084210514 11:67619359-67619381 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1084259176 11:67963545-67963567 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1084813598 11:71631634-71631656 AAGCACCGCCCCCTGCTCCACGG - Intergenic
1085375938 11:76060887-76060909 GAGCACTGTCCCCTGCTCCATGG + Intronic
1085447198 11:76609067-76609089 GAGCATCACTCCCTGCTCCACGG - Intergenic
1085671045 11:78465008-78465030 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1085687746 11:78639178-78639200 GAGTGCTGCCCCCTGCTCCGTGG + Intergenic
1085863187 11:80257883-80257905 GAGCGCCGACCCCTGCTCAAGGG + Intergenic
1085886903 11:80532775-80532797 GGGCGCTGCCCCCTGCTCTGTGG - Intergenic
1086034956 11:82404213-82404235 AAGCGTCGCCCCCTGCTCCACGG + Intergenic
1086043082 11:82501480-82501502 GAGCACCACCCCCTGCTCCACGG + Intergenic
1086087617 11:82970996-82971018 CAGCGCCGCCCCATGCTCCAAGG + Intergenic
1086210074 11:84308588-84308610 CAGCGCCGCCCCCTGCTCCACGG - Intronic
1086397698 11:86433561-86433583 AAGCGCTGCCCCCTGCTCCATGG - Intergenic
1086484740 11:87286558-87286580 GGGCGCCGCCCCCTGCTCTGTGG - Intronic
1086552560 11:88069370-88069392 GGGCACCAACCCCTGCTCAGTGG + Intergenic
1086724682 11:90167464-90167486 GAGCACCGCTTCCTGCTCCACGG + Intronic
1086808067 11:91269078-91269100 GAGTGCTGCCCCCTGCTCCATGG + Intergenic
1087354589 11:97076922-97076944 GAGCACCACCCCATGCTCCATGG + Intergenic
1087682298 11:101231373-101231395 GAGCACCGCCCCCTGCTCTGTGG - Intergenic
1088570927 11:111222299-111222321 CAGCGCCGCCCCCTGCTCCACGG + Intergenic
1089373519 11:117978525-117978547 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1089666912 11:120026222-120026244 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1089800293 11:121021982-121022004 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1090004050 11:122984566-122984588 CAGGGCCGCCCCCTTCTCCGGGG + Intergenic
1090133513 11:124170759-124170781 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1090228123 11:125083702-125083724 GACCACTGCCCCCTTTTCCGAGG - Intronic
1090229277 11:125089819-125089841 GAGTACCACCCCCTGCTCCAGGG + Intronic
1090307632 11:125704740-125704762 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1090403072 11:126461270-126461292 GAGCACCGCCTCCTCCTGTGTGG - Intronic
1090558097 11:127898607-127898629 GGGCACCGCCCCATGCTCCGTGG - Intergenic
1090776673 11:129971870-129971892 GAGCGCCGCCCCCTGCTCTACGG - Intronic
1090820480 11:130337434-130337456 CAGCGCCACCCCCTGCTCCACGG - Intergenic
1091233405 11:134002927-134002949 GAGCGCCGCCCCCCGCTCCACGG - Intergenic
1091402202 12:188155-188177 CAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1092101653 12:5888933-5888955 GAGCACAGCTCCCTGCTCCAAGG - Intronic
1092133973 12:6132803-6132825 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1092135253 12:6142519-6142541 GAGCACCACCCCCTGCTCCACGG + Intergenic
1092142058 12:6190909-6190931 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1092220336 12:6708605-6708627 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1092272974 12:7037743-7037765 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1092336730 12:7640161-7640183 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1092350467 12:7752107-7752129 GAGCGCCACCCCCTGCTCCAAGG - Intergenic
1092364105 12:7862508-7862530 GAATGCCGCCCCCTGCTCCACGG + Intronic
1092410885 12:8252229-8252251 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1092430488 12:8404550-8404572 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1092471819 12:8787589-8787611 GAGGGCCACCCCCTGCTCCACGG + Intergenic
1092473014 12:8795048-8795070 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1092545809 12:9450446-9450468 GAGCGCCGCCCCCTAATCCGCGG - Intergenic
1092572368 12:9739614-9739636 GAGCGCCGCCCCCTGCTTCACGG - Intergenic
1092617101 12:10225666-10225688 GAGCACCACCCCCTGCTCCACGG - Intergenic
1092732504 12:11547570-11547592 AAGCGCCACCCCCTGCTCCGCGG + Intergenic
1093034549 12:14320416-14320438 GACCGCCGCCCCCCGCTCCAGGG + Intergenic
1093172393 12:15874911-15874933 GAGTGCCACCCCCTGCTCCATGG + Intronic
1093189452 12:16057697-16057719 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1093381615 12:18500467-18500489 GAGCGCGGCCCCCTGCTCCACGG + Intronic
1093524746 12:20093359-20093381 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1093527041 12:20115268-20115290 GAGCACCGTCCCCTGCTCCACGG - Intergenic
1093580121 12:20777449-20777471 AAGTGCCGCCCCCTGCTCCATGG - Intergenic
1093580980 12:20783818-20783840 GAGTGCCGCCCCCTGCTCCATGG - Intergenic
1093793769 12:23286250-23286272 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1093970260 12:25369688-25369710 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1094327611 12:29256965-29256987 GAGCGCCACCCCCTGCTCCAGGG + Intronic
1094338552 12:29386279-29386301 TAGCGCGGCCCCCTGCTCCACGG - Intergenic
1094405311 12:30110520-30110542 GAGCGCTGCTCCCTGCTCCAGGG - Intergenic
1094409888 12:30157182-30157204 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1094448775 12:30561955-30561977 GAGCACCACCCCCTGCTCCATGG + Intergenic
1094507146 12:31071627-31071649 GAGCGCCGCCCCCTAATCCGCGG + Intergenic
1094589250 12:31805827-31805849 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1094661334 12:32472614-32472636 GAGCACCACCCCCTGCTCCACGG + Intronic
1094666535 12:32525994-32526016 GAGCACCACCCCCTGCTCCACGG + Intronic
1094722094 12:33075626-33075648 GAGCGCTGCCCCCTGCTCCATGG + Intergenic
1094833247 12:34310015-34310037 GAGCACCGCCCTCTGCTCAGTGG + Intergenic
1095444911 12:42273746-42273768 GAGTGCTGCCCCCTGCTCCACGG - Intronic
1095587461 12:43864221-43864243 CAGCACCTCCCCCTGCTTCATGG + Intronic
1095642427 12:44500710-44500732 GAGTGCCGCCCCCTGCTCCGTGG + Intergenic
1095901594 12:47333703-47333725 GAGCGCTGCCCCCTGCTCCATGG + Intergenic
1097011135 12:55954227-55954249 GAGAACAGCCCCCTCCTCAGTGG - Exonic
1097017870 12:56000184-56000206 GAGCACCGACCCCTGCTCCACGG - Intronic
1097128887 12:56795877-56795899 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1097253734 12:57656086-57656108 GAGCGCCACCCCCTGCTCGACGG + Intergenic
1098168166 12:67719270-67719292 GAGCAACGCCCCCTGCTCCACGG - Intergenic
1098498708 12:71166238-71166260 GAGTGCCGCCCCCTTCTCCAAGG - Intronic
1098588727 12:72185368-72185390 GAGCACCACCCCCTGCTCCACGG + Intronic
1099191443 12:79565276-79565298 GAGTGCTGCCCCCTGCTCCATGG + Intergenic
1099192477 12:79574194-79574216 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1099228108 12:79993262-79993284 AAGCGCCGCCCCCTGCTCCACGG - Intergenic
1099450539 12:82802076-82802098 GAACGCCACCCCCTGCTCCATGG - Intronic
1099523892 12:83696333-83696355 GAACACCACCCCCTGCTCCATGG - Intergenic
1099559574 12:84155161-84155183 GAGCACCACCCCCTGCTCCACGG - Intergenic
1099716183 12:86296440-86296462 GAATGCCGCCCCCTGCTCCACGG - Intronic
1100142396 12:91634273-91634295 GATCGCCGCCCCCTGCTCCAGGG + Intergenic
1100166571 12:91923946-91923968 GAGTGCGGCCCCCTGCTCCACGG - Intergenic
1100211834 12:92406556-92406578 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1100521505 12:95379907-95379929 AAGCACCACCCCCTGCTCCACGG + Intronic
1100600683 12:96109184-96109206 GAGCGCCACCCCCTGCTCCAGGG + Intergenic
1101009041 12:100430624-100430646 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1101021675 12:100559704-100559726 GAGCACCACCCCCTGCTCCACGG + Intronic
1101461914 12:104905550-104905572 GAGCGCCACCCCCTGCTCCACGG - Intronic
1101581012 12:106040637-106040659 GAGCCCTGCCCCCTGCTGAGTGG - Intergenic
1102309810 12:111835975-111835997 GAGCACCACCCCCTGCTCCACGG + Intergenic
1102387200 12:112519970-112519992 GAGCACCGCCCTCTGCTCCAGGG - Intergenic
1102904060 12:116661004-116661026 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
1103238886 12:119397752-119397774 GGGCGCTGCCCCCTGCTCCGTGG - Intronic
1103439175 12:120950364-120950386 GACCACCGCCCCCTGCTCCACGG - Intergenic
1103678667 12:122676674-122676696 GAGCACGGCCCCCTGCTCCATGG - Intergenic
1103783343 12:123414151-123414173 GAGCCCCACCCCCTGCTCCATGG - Exonic
1103916658 12:124379249-124379271 CCGCACCGCACCCTGCTCCTGGG + Intronic
1104344543 12:127983707-127983729 AAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1104373936 12:128247571-128247593 GGGTGCCGCCCCCTGCTCCTTGG + Intergenic
1104582686 12:130022377-130022399 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1104614466 12:130256692-130256714 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1104749292 12:131228134-131228156 GAGCACCACCCCCTGCTCCACGG + Intergenic
1104884766 12:132100355-132100377 GAGGACCGGCCCCTCCTCCCAGG + Intronic
1104957789 12:132474778-132474800 GACCCCCGCCCCCTCCTCCGCGG + Intergenic
1104957819 12:132474848-132474870 GACCCCCGCCCCCTCCTCCGCGG + Intergenic
1105037803 12:132939076-132939098 GAGCACCACCCCCTGCTCCACGG + Intronic
1105593925 13:21818226-21818248 GAGCACTGCCCCCTGCCCTGTGG + Intergenic
1105697181 13:22900487-22900509 GAGCCCCGCCCGCTGCTCCAGGG - Intergenic
1105722220 13:23127893-23127915 GAGCACCACCCCCTGCTCCACGG + Intergenic
1105777594 13:23677867-23677889 GAGCCCCGCCCCCTGCTCCATGG - Intergenic
1106221277 13:27748352-27748374 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1106617015 13:31339704-31339726 GAGCACCACCCCCTGCTCCACGG - Intergenic
1106643385 13:31608867-31608889 GAATGCCGCCCCCTGCTCCACGG - Intergenic
1106810998 13:33358303-33358325 GAGCACCACCCCCTGCTCCACGG + Intergenic
1107259332 13:38472468-38472490 GAGCGCCATCCCCTGCTCCACGG - Intergenic
1107590414 13:41898617-41898639 GAATGCCGCCCCCTGCTCCACGG - Intronic
1107652626 13:42560048-42560070 AAGCGCCGCCCCCTGCTCCATGG + Intergenic
1107836165 13:44413897-44413919 GAGCACTGCCCCCTGCTCCACGG + Intergenic
1108099129 13:46936093-46936115 GAGCACCACTCCCTGCTCCATGG - Intergenic
1108435395 13:50396911-50396933 GAGCACCGCCCCCTGCTCCAGGG + Intronic
1108469408 13:50753345-50753367 GAGCGCCGCCCCCTGCTCCAGGG - Intronic
1108751488 13:53452432-53452454 CAGCACCACCCCCTGCTCCACGG - Intergenic
1108845724 13:54676892-54676914 GGGCACCACCTCCTGCTTCGTGG + Intergenic
1108851565 13:54737314-54737336 GAGCGCCACCCCCTGCTCCAGGG - Intergenic
1108856493 13:54799759-54799781 GAGCGCCGCCCCCTACTCCATGG - Intergenic
1108858910 13:54829538-54829560 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1108996049 13:56735885-56735907 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1109110968 13:58318573-58318595 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
1109124669 13:58504309-58504331 GAGCACTGCCTCCTGCTCCACGG - Intergenic
1109141098 13:58714405-58714427 GAGCGCCAGCCCCTGCTCCACGG + Intergenic
1109145442 13:58773594-58773616 GAGCACTGCCCCCTGCTCCAGGG + Intergenic
1109152070 13:58858894-58858916 GAGCGCCGCCCCCTGCTCCCTGG - Intergenic
1109201916 13:59440234-59440256 GAGCACCGCCCCCTTCTCCACGG + Intergenic
1109441414 13:62379551-62379573 GAGCACCACCCCCTACTCCACGG + Intergenic
1109446561 13:62447937-62447959 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1109745865 13:66622271-66622293 GAGTGCAGCCCCCTGCTCCACGG + Intronic
1109854248 13:68107757-68107779 AAGCGCCGCCCCCTGTTCCACGG - Intergenic
1109858853 13:68171239-68171261 GAGCACCGCCCCCTTCTCCACGG + Intergenic
1110064584 13:71087566-71087588 GGGCGCTGCCCCCTGCTCTGTGG + Intergenic
1110497898 13:76190412-76190434 GAACACCACCCCCTGCTCCGCGG + Intergenic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1110854156 13:80278692-80278714 GAGCACTGCCCCCTGCTCCATGG - Intergenic
1110874314 13:80490595-80490617 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1110999792 13:82164985-82165007 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1111006696 13:82258282-82258304 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1111138746 13:84086452-84086474 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1111220970 13:85205247-85205269 CTGCTCCGCCCCCTGCTCCGCGG + Intergenic
1111441953 13:88292142-88292164 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1111556129 13:89883904-89883926 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1111591079 13:90348921-90348943 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1111602772 13:90495102-90495124 GAGCACCACCCCCTGCTCCACGG + Intergenic
1111748377 13:92296988-92297010 GAGCACCACCCCCTGCTCCATGG + Intronic
1111841364 13:93454824-93454846 CAGCTCCACCCCCTGCTCCAGGG - Intronic
1112077700 13:95931475-95931497 GAGTGCTGCCCCCTGCTCCGCGG - Intronic
1112226555 13:97545607-97545629 GAGCGCCGCTCCCTGCTCCACGG + Intergenic
1112325687 13:98441547-98441569 GAGCAGCGTTCCTTGCTCCGGGG + Intronic
1112518695 13:100077838-100077860 GAGCGCTGCCCCCTGCTCTACGG + Intergenic
1112533121 13:100224087-100224109 GTGCGCCGCCCCCTGCTCCACGG - Intronic
1112613148 13:100976018-100976040 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1112842735 13:103600261-103600283 AAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1113371904 13:109732707-109732729 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1113482635 13:110633067-110633089 GAGCACCACCCCCTGCTCCACGG - Intronic
1113506684 13:110821482-110821504 GAGCACTACCCCCTGCTCCACGG + Intergenic
1113517601 13:110915183-110915205 AAGCCCCGCCCCCTGCCCGGCGG - Intergenic
1113538081 13:111083910-111083932 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1113678103 13:112222039-112222061 GAGCACTACCCCCTGCTCCACGG + Intergenic
1113680328 13:112239053-112239075 AGGCACCGCCCCCTGCTCTGTGG + Intergenic
1114063020 14:19037616-19037638 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1114099239 14:19362381-19362403 GACCCCTGCCCCCTGCTCCCCGG + Intergenic
1114485067 14:23057367-23057389 GATTCCCGACCCCTGCTCCGGGG + Intronic
1114559766 14:23581068-23581090 GAGCTCTGCCCCCTGCTCAGCGG + Intergenic
1114593586 14:23892080-23892102 GAGCACCACCCCCTGCTCCACGG + Intergenic
1114679607 14:24473429-24473451 AAGCACTGCCCCCTGCTCCAGGG + Intergenic
1114957816 14:27845696-27845718 CGGCACCGCCCTCTGCTCCGCGG + Intergenic
1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG + Intronic
1115533199 14:34345844-34345866 GAGTGCCGCCCCCTGCTCCGTGG - Intronic
1115993109 14:39170012-39170034 CACCACCTCCCCCTGCTCCGCGG + Exonic
1116114453 14:40629679-40629701 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1116152071 14:41154284-41154306 GGGCGCCGCCCCCTGTTCCTTGG - Intergenic
1116250988 14:42482431-42482453 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1116311057 14:43326925-43326947 GAGCACCACCCCCTGCTCCACGG + Intergenic
1116390573 14:44385065-44385087 GAACGCCACCCCCTGCTCCACGG + Intergenic
1116426639 14:44799010-44799032 GAGCACTGGCCCCTGCTCCACGG + Intergenic
1116452410 14:45080758-45080780 GAGCGACGCCCCCTGCTCCACGG + Intergenic
1116624064 14:47242766-47242788 GAGCACCACCCCCTGCTCCAGGG + Intronic
1116657032 14:47665883-47665905 GAGCGCGGCCCCCTGCTCCATGG + Intronic
1117077914 14:52122566-52122588 AAGCGCCACCCCCTGCTCCAGGG + Intergenic
1117183594 14:53217558-53217580 CGGCGCCGCCCCCTGCTCCTAGG - Intergenic
1117297426 14:54393017-54393039 GGGCGCCGCTCCCTGCTCCAGGG - Intergenic
1117297613 14:54393762-54393784 GAGCGCCGCCTCCTGCTCCAGGG + Intergenic
1117302563 14:54443374-54443396 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1117449858 14:55839789-55839811 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1117565680 14:56991339-56991361 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
1117571877 14:57056654-57056676 GAGCACCACCCCCTGCTCCACGG - Intergenic
1117742666 14:58834240-58834262 AAGTGCTGCCCCCTGCTCCGCGG + Intergenic
1118215322 14:63803302-63803324 TAGCACCACCCCCTGCTCCATGG - Intergenic
1118932469 14:70255165-70255187 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1119027819 14:71167815-71167837 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1119300273 14:73566371-73566393 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1119486831 14:74994471-74994493 GAATGCCGCCCCCTGCTCCACGG + Intergenic
1119673402 14:76536789-76536811 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1120229718 14:81829503-81829525 GAGCGCAGCCCCCTGCTTCGGGG - Intergenic
1120331029 14:83092706-83092728 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1120439061 14:84512947-84512969 GAGCGCCGCCCCCTGCTGCACGG - Intergenic
1120632260 14:86905462-86905484 GAACGCCGCCTCCTGCTCCAAGG - Intergenic
1120704708 14:87734769-87734791 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1121350611 14:93170155-93170177 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1122216479 14:100208204-100208226 GAGCGCCGTCCCCTGCTCCAGGG - Intergenic
1122323031 14:100866885-100866907 GAGCCCCGCCTCCTGGTCCCAGG - Intergenic
1122493406 14:102135549-102135571 GAGCACCACCTCCTGCTCCACGG - Intronic
1122514582 14:102298011-102298033 GAGCACCGCCCCCTGCTCCAGGG + Intronic
1122894779 14:104751562-104751584 TTGCGCGGCCCCCTGCTCCGCGG - Intergenic
1123799192 15:23803236-23803258 GAGCGCCGCCGCCTGCTCCAGGG + Intergenic
1123949081 15:25253231-25253253 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1124036406 15:26057195-26057217 GAGCGCTGCCCCCTGCTCCATGG + Intergenic
1124110565 15:26781706-26781728 GAGCGCTGCCCGCTGCTCCATGG - Intronic
1124114803 15:26831217-26831239 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1124198544 15:27656486-27656508 GAGTGCCGCCCCCTGCTCCGTGG - Intergenic
1124380314 15:29159960-29159982 GAGCGCCGCCTCCTGCTCCATGG - Intronic
1124387812 15:29224831-29224853 GTGCACCGCCCCCTGCTCCACGG - Intronic
1124573178 15:30884079-30884101 GAGCACCACCCCCTGCTCCACGG + Intergenic
1124818429 15:33019519-33019541 AAGCGCCGCCCCCTACTCCAGGG - Intronic
1125112266 15:36047276-36047298 GAATGCCGCCCCCTGCTCCACGG + Intergenic
1125565706 15:40676965-40676987 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1125609746 15:40961940-40961962 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1125631635 15:41151961-41151983 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1125885503 15:43226626-43226648 GAGCGCCGCCCTCTGCTCCACGG - Intergenic
1125914503 15:43473911-43473933 GAGCACTGCCCCCTGCTCCACGG - Intronic
1126089043 15:45035157-45035179 GAGTGCCGCCCCCTGCTGCACGG + Intronic
1126128130 15:45314415-45314437 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1126134556 15:45378082-45378104 GGGCGGCGCCCCCTGCGCCGTGG + Intronic
1126639721 15:50812291-50812313 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
1127211646 15:56779969-56779991 GAGTGCCGCCCCCTGCTCCACGG + Intronic
1128110893 15:65075347-65075369 GAGCACTACCCCCTGCTCCACGG + Intronic
1128594061 15:68928992-68929014 GAGCGCCGCTCCCTGCTCCACGG - Intronic
1128598523 15:68975707-68975729 GAGCGCCGTCCCCTACTCCACGG - Intronic
1128727224 15:69997259-69997281 GAGCCCCGCCCTCTGCCCAGCGG + Intergenic
1129196972 15:73974031-73974053 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1129208679 15:74052822-74052844 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1129280348 15:74480383-74480405 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1129373965 15:75116034-75116056 GAGCGCCACCCCTTGCTCCAAGG - Intronic
1129986941 15:79926397-79926419 GAGCACCGACCCCTGCTCCACGG + Intergenic
1129997188 15:80016800-80016822 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1130132916 15:81158944-81158966 GAGCACCGCCGCCTGCTCCACGG + Intergenic
1131144623 15:90002635-90002657 GGCCACCGCCCCCTTCACCGCGG + Intronic
1131250296 15:90825796-90825818 GAGCGCTGCTCCCTGCTCCATGG + Intergenic
1131472785 15:92711097-92711119 GAGCACCGCCCCCTGCTCCAAGG - Intronic
1131846064 15:96491871-96491893 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1131846081 15:96491922-96491944 GCGCACCGCCCCCCGCCCCGGGG - Intergenic
1131892138 15:96984213-96984235 CAGCGCCGCCCCCTGCTCCACGG - Intergenic
1131992340 15:98104303-98104325 GAGCGCCGCTCCCTGCTCCAGGG - Intergenic
1132155797 15:99494715-99494737 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1132382816 15:101378626-101378648 GAGCCAGGCCCCCTGCTCCAAGG - Intronic
1132664294 16:1074529-1074551 GAAGACTGCCCCCTTCTCCGAGG + Intergenic
1132691131 16:1182431-1182453 GAGCACCGCCCCCAGCGCAGGGG - Intronic
1132836768 16:1958238-1958260 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1133286749 16:4694254-4694276 GGGCCCCGCCCCCCGCCCCGGGG + Intronic
1133362608 16:5186402-5186424 GAGCGCCACTCCCTGCTCCAGGG - Intergenic
1133367485 16:5222048-5222070 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1134903902 16:17962917-17962939 CACCACCCCCCCCTGCCCCGGGG + Intergenic
1135262076 16:20989680-20989702 GAGCACCACCCCCTGCTCCACGG - Intronic
1135280903 16:21152920-21152942 GAGCGCCACCCCCTGCTCCACGG + Intronic
1135299345 16:21312818-21312840 GAGCATCACCCCCTGCTCCATGG - Intergenic
1135470176 16:22723034-22723056 AAGCTCCGCTCCCTGCTCCACGG - Intergenic
1135577370 16:23596173-23596195 CAGCACCGCTCTCTGCTCCGCGG - Exonic
1135738105 16:24949866-24949888 GAGCTCAGCCCCCTGATCTGTGG - Intronic
1135751014 16:25058948-25058970 GAGCACCACCCCCTGCTCCACGG - Intergenic
1135942653 16:26836136-26836158 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1136199617 16:28679296-28679318 GAGCACTGTCCCCCGCTCCTCGG - Intergenic
1136215963 16:28793469-28793491 GAGCACTGTCCCCCGCTCCTCGG - Intergenic
1136356684 16:29748648-29748670 CTGCACCGCCCCCTGCTCTGCGG + Intergenic
1136561059 16:31039530-31039552 GATCATCTCCCCCTGCTCAGAGG - Exonic
1137300476 16:47143821-47143843 GGGCGCCGCCTCCTGCTCCGCGG + Exonic
1137945736 16:52731730-52731752 GAGAGCCGCCCCCTGCTCCATGG + Intergenic
1137988671 16:53131124-53131146 GAGCAGCGGCCGCTGCCCCGCGG - Intronic
1138168887 16:54830138-54830160 CAGCACTGCCCCCTACTCCATGG + Intergenic
1138503357 16:57462870-57462892 CACCCCCGCCCCCTGCCCCGGGG - Intronic
1138688830 16:58749179-58749201 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1138693555 16:58790807-58790829 GAGCGCGGCCCCCTGCTCCACGG - Intergenic
1138889825 16:61128793-61128815 GGGCGCCCTCCCCTGCTCCGTGG - Intergenic
1139147786 16:64344216-64344238 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1139919539 16:70450833-70450855 GAGCGCCGCTCCCTGCTCCACGG - Intergenic
1140722471 16:77784422-77784444 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1141465697 16:84204653-84204675 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1141832302 16:86516629-86516651 CAGCTCCTGCCCCTGCTCCGGGG - Intergenic
1142001713 16:87668089-87668111 GAGCGCAGCGCCCGGCTCCGTGG + Intronic
1143022955 17:3926107-3926129 GAGGACCGCCCCCAGCCCCCAGG + Intronic
1143075444 17:4338934-4338956 GAGCACTACTCCCTGCTCAGGGG + Intronic
1143127942 17:4656587-4656609 GAGCGCTGCCCCCTGCTCCAAGG - Intergenic
1143135226 17:4709130-4709152 GAGCACCGCCCCCTGCTCCAAGG - Intergenic
1143283410 17:5771539-5771561 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
1143460468 17:7100632-7100654 CAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1143552775 17:7641159-7641181 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1143708604 17:8718115-8718137 AAGAGCCGCCCCCTGCTCCATGG - Intergenic
1144128131 17:12221186-12221208 AAGCGCCGCCCCCTGCTCCACGG + Intergenic
1144723256 17:17486676-17486698 GAGCACCACCCCCTGCTCCAGGG + Intronic
1145094883 17:20016747-20016769 CAGCACCACCCCCTGCTCCACGG + Intronic
1146740414 17:35278952-35278974 GAGCGCCATCCCCTGCTCCAGGG - Intergenic
1147997582 17:44369126-44369148 GAGCGGCGCCCCCTGCTCCACGG + Intergenic
1148023419 17:44568507-44568529 GAGCGCTGCCCCCTGCTCTAGGG + Intergenic
1148366128 17:47057320-47057342 GAGCGCCACCCCCTGCTTCACGG - Intergenic
1148890314 17:50802372-50802394 GAGCTCCTCCCCCAGCTCCAGGG + Intergenic
1149916440 17:60613939-60613961 GAGCACCACCCCCTGCTCCACGG + Intronic
1150682554 17:67295033-67295055 GATCGCCGCCCCCTGCTCCAGGG + Intergenic
1150786710 17:68169396-68169418 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1150788321 17:68180175-68180197 GAGCACGGCCCCCTGCTCCACGG + Intergenic
1150792277 17:68208136-68208158 GAGCACCGCCCCCTGCCCCACGG + Intergenic
1151453311 17:74212389-74212411 GAGCCCCGCCCCGTCCTCCCGGG + Intergenic
1151477408 17:74351946-74351968 GAGCACCTCGCGCTGCTCCTCGG - Exonic
1151601702 17:75109978-75110000 GCGCACCGTCCCCGGCTCCTGGG - Exonic
1151866482 17:76806438-76806460 GAGCGCCGCCACCTGCTCCAGGG + Intergenic
1151973752 17:77472388-77472410 GACCCCCGCCCCCTGCCTCGGGG + Intronic
1152533990 17:80939972-80939994 GAGCGCCTCTCCCAGCTCCGGGG + Intronic
1152618996 17:81352071-81352093 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1152648586 17:81481665-81481687 CAGCGCGGACCCCTGCTCCGGGG - Intergenic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1153644007 18:7178704-7178726 GAGCGCCTCCCCCTGCTCCACGG - Intergenic
1154097556 18:11432320-11432342 AGGCGCCGCCCCCTGCTCCGAGG - Intergenic
1154231108 18:12557184-12557206 GGGCGCCACCCCCTGCTCCGCGG - Intronic
1154231381 18:12559119-12559141 GGGCGCCTCCCCCTGCTCCAAGG - Intronic
1154255261 18:12776884-12776906 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1154294068 18:13134723-13134745 GAGCGCCGCTCCCTGCTCCGTGG - Intergenic
1154332307 18:13440154-13440176 GAGCCCCGGCCTCTGCTCTGGGG + Intronic
1154451058 18:14475031-14475053 GACCCCTGCCCCCTGCTCCCCGG + Intergenic
1155207998 18:23577667-23577689 GAGCGCCACCCCCTGCTCCACGG - Intronic
1155611665 18:27673927-27673949 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1155772922 18:29723840-29723862 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1155806249 18:30175131-30175153 TAGCGCCGCCGCCTGCTCTGTGG - Intergenic
1155852324 18:30788767-30788789 GAGCGCTGCCCCTTGCTCCATGG + Intergenic
1155856329 18:30839196-30839218 GAGGACCACTCCCTGCTCCAAGG - Intergenic
1155976818 18:32140145-32140167 GAACCCTGCCCCCTGCTCCACGG + Intronic
1156038719 18:32794897-32794919 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1156079549 18:33316512-33316534 GAGCGCCGCCCCCTGCTGGATGG + Intronic
1156150358 18:34234166-34234188 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1156242988 18:35271690-35271712 GGGTGCCGCCCCCTGCTCCGTGG - Intronic
1156629009 18:38944445-38944467 AGGCACCGCCCCCTGCTCCACGG - Intergenic
1156651987 18:39235658-39235680 AGGCACTGCCCCCTGCTCCGTGG + Intergenic
1156657875 18:39309415-39309437 GGGAGCCACCCCCTGCTCCGTGG + Intergenic
1156683622 18:39618787-39618809 AAGCACCGCCTCCTGCTCTGTGG + Intergenic
1156863703 18:41866080-41866102 TAGCACCACCCCCTGCTCCATGG + Intergenic
1156943216 18:42795554-42795576 GAGCGCAGCCCCCTGCTCCACGG + Intronic
1157086017 18:44581056-44581078 AAGCACCACCCCCTGCTCCACGG + Intergenic
1157856861 18:51111881-51111903 GAGTGCTGCCCCCTGCTCCACGG - Intergenic
1157858329 18:51120995-51121017 GAGTGCCGCCCCCTGCTCCAAGG - Intergenic
1157979752 18:52366941-52366963 GAGCACCACCCCCTGCTCCACGG - Intronic
1158351970 18:56572613-56572635 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1158553929 18:58459699-58459721 AAGCGCCACCCCCTGCTCCAGGG + Intergenic
1158697212 18:59714130-59714152 GAGCACCACCCCCTGCTCCACGG - Intergenic
1158705705 18:59790489-59790511 GAGCACCACCCCCTGCTCCACGG - Intergenic
1159167904 18:64725677-64725699 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1159656056 18:71031375-71031397 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1159744005 18:72209450-72209472 GAGCGCCGCCCCCTTCTCCGCGG + Intergenic
1160176571 18:76600168-76600190 GAGCACCACCCCCTGCTCCACGG - Intergenic
1160198605 18:76777567-76777589 GAGCACCACCCCCTGCTCCACGG + Intergenic
1160445508 18:78924506-78924528 GCGCTCCGCCCCCTGCCCCTGGG + Intergenic
1160887038 19:1354959-1354981 AAGCCCCGCCCCCGGCCCCGCGG + Intronic
1161166516 19:2790768-2790790 GGGCAGCGCCACCTGCTCCCAGG + Intronic
1161400181 19:4063842-4063864 TAGTACCGGCACCTGCTCCGAGG + Intronic
1161683890 19:5693803-5693825 GAGCACCGGCCTGGGCTCCGAGG - Intronic
1161795033 19:6381511-6381533 AAGCACCGCCCCCATCTCCCCGG + Intronic
1162007181 19:7788327-7788349 GAGCAGCGCCGCGCGCTCCGTGG - Intergenic
1162107047 19:8376087-8376109 GAGCACTGCCCCATGCTCCATGG + Intronic
1162230196 19:9259836-9259858 GAGCGCTGTCCCCTGCTCCACGG + Intergenic
1162233059 19:9283491-9283513 GAGCGCCACCCTCTGCTCCGCGG - Intergenic
1162237797 19:9321919-9321941 AAGTGCCGCCCCCTGCTCCACGG + Intergenic
1162263097 19:9548125-9548147 GGGCGCCACCCCCTGCTCCATGG + Intergenic
1162814678 19:13186742-13186764 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1162987145 19:14277929-14277951 CAGCGCCGCCCCCTGCTCCGCGG + Intergenic
1163054537 19:14708388-14708410 AAACACCGACCCCTCCTCCGTGG + Intronic
1163122037 19:15223862-15223884 GAGCAATGCCCCCCGCCCCGGGG - Intergenic
1163181677 19:15608683-15608705 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1163218898 19:15900006-15900028 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1163262263 19:16198317-16198339 CTGCACCGCCCTCTGCTCCCCGG + Intronic
1163370006 19:16896610-16896632 GATCGCCGCCCCCTCCTCAGGGG + Exonic
1164143986 19:22499026-22499048 GAGCGCCACCCCCTGCTCCACGG - Intronic
1164310507 19:24041637-24041659 GAGCACCACCCCCTGCTCCACGG + Intronic
1164643640 19:29843531-29843553 GACTGCCGCCCCCTCCTCCGGGG - Intergenic
1164975845 19:32571907-32571929 GAGCACCACCCACTGCTCCAGGG + Intergenic
1165036426 19:33036920-33036942 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1165058729 19:33194744-33194766 GGGCGCCGCCTCCTGCCCCGCGG - Exonic
1165079355 19:33298698-33298720 GAGCCCCGCCGCGTGCCCCGAGG - Intergenic
1165248635 19:34512996-34513018 GAGGGCCGCCCTCTGCTCCCAGG - Intergenic
1165822703 19:38686648-38686670 GAGCACTGCCTCCCGCTCTGTGG + Intronic
1165846635 19:38821819-38821841 GAGCGCCACCCCCTGCTCGGCGG + Intronic
1165928541 19:39342217-39342239 GAGGCCCGCCCCCTCCTCGGCGG - Intronic
1166036168 19:40170178-40170200 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1166066952 19:40365798-40365820 GAGCTCCGCCCACTGCAGCGGGG - Exonic
1166338942 19:42125842-42125864 GAGCATCTCCCCCTGCTTGGGGG + Intronic
1166649685 19:44563279-44563301 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1166976922 19:46610232-46610254 CAGCACCTCCCGCTTCTCCGTGG + Exonic
1167134738 19:47609672-47609694 GATCACCGCCCGCTGCCCGGTGG - Intronic
1168408197 19:56121405-56121427 GGCCACCGCCCCCAGCTCTGTGG + Intergenic
924967419 2:91312-91334 GAGCGCCACCCCCTGTTCCGCGG + Intergenic
924977430 2:191396-191418 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
925080131 2:1056727-1056749 GAGCACGGCGCCCTGCTGTGGGG + Intronic
925329677 2:3048824-3048846 GAGCACCACCCCCTCCCCTGGGG - Intergenic
925533026 2:4884538-4884560 GGGCACCACGCCCTGCTCCGCGG + Intergenic
926092086 2:10057830-10057852 GAGCTCCGCCCCCTGTTCCCAGG + Exonic
926097539 2:10091740-10091762 GAGTGTCGCCCCCTGCTCCACGG + Intergenic
926437619 2:12854119-12854141 GAGCGCTGCTCCCTGCTCCACGG - Intergenic
926850696 2:17193834-17193856 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
927357117 2:22186621-22186643 GAGCGCCGCCCCCTCTTCCACGG + Intergenic
927567190 2:24123485-24123507 GCACTCCGCCCCCTGCGCCGCGG - Exonic
927777841 2:25915784-25915806 GAGCGCCGCCTCCTGCTCCACGG + Intergenic
927942149 2:27111551-27111573 GAGCGCCACCCCCTGCTCCACGG - Intronic
928106400 2:28472954-28472976 GAGCACCGCCCCTTGCTCCATGG + Intronic
928369588 2:30731505-30731527 AAGCAGCCCCTCCTGCTCCGCGG + Intronic
928617895 2:33057464-33057486 GAGAGCTGCCCCCTGCTCCACGG - Intronic
928753243 2:34494616-34494638 GAGCGCCACCCCCTGCTCCACGG + Intergenic
928880623 2:36092562-36092584 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
928936947 2:36688583-36688605 GAGCGCCACCCCCTGCTCCACGG + Intergenic
929070107 2:38020833-38020855 GAGCGCCACCCCCTGCTCCACGG + Intronic
929109907 2:38397585-38397607 GAGCACCGCCCCCTCCTCCATGG + Intergenic
929201904 2:39244598-39244620 GAGTGCCACCCCCTGCTCCACGG + Intergenic
929379735 2:41335913-41335935 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
929890820 2:45917708-45917730 GAGCGCCGCCCCCTGCTCCACGG - Intronic
930038060 2:47100055-47100077 GAGTGCCGCCCCCTGCTCCAAGG + Intronic
930039261 2:47107603-47107625 GAGTGCCGCCCCCTGCTCCATGG + Intronic
930420833 2:51151652-51151674 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
930468184 2:51780373-51780395 GAGCGCCGCCCCCAGCTCCACGG - Intergenic
930485562 2:52007131-52007153 GAGCACTGTCCCCTGCTCCAGGG + Intergenic
930593439 2:53356753-53356775 AGGCACCGCCCCCTGCTCCACGG + Intergenic
931708736 2:64969327-64969349 GAGCGCCGCCCCCCGCTCCACGG + Intergenic
931719442 2:65056569-65056591 GGCCACCGCCCCCAGCGCCGCGG - Intronic
932359474 2:71092525-71092547 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
932486527 2:72087204-72087226 GAGCACCACCCCCTACTCCACGG + Intergenic
932521821 2:72422149-72422171 GAGCACCACCCCCTGCTCCAGGG + Intronic
932902094 2:75711897-75711919 GAGCACCACCCCCTGCTCCACGG + Intergenic
933060794 2:77734823-77734845 CAGCACCGCTCCCTGCTCCAGGG - Intergenic
933139863 2:78779319-78779341 GGGCGCCACCCCCTGCTCAGGGG + Intergenic
933415871 2:81985480-81985502 GGGCTCCGCTCCCTGCTCCACGG + Intergenic
933487206 2:82938480-82938502 GAGCACCACCCCCTGCTCCACGG - Intergenic
933712113 2:85334451-85334473 GAGCACCGCCCCCTGCTCCACGG - Intergenic
934085165 2:88503418-88503440 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
934479488 2:94622238-94622260 CTGCACTGCCCCCTGCTTCGCGG - Intergenic
934898542 2:98139325-98139347 GAGCGCCACCCCCTGCTCCACGG + Intronic
935866482 2:107392608-107392630 GAGCGCCGCCCCCTGCTCCGCGG + Intergenic
935896802 2:107747376-107747398 GAGCGCCGCCCCCTGCTCCGGGG - Intergenic
936346936 2:111682173-111682195 GAGCGCCACCCCCTGCTCCACGG + Intergenic
937209548 2:120259788-120259810 GAGCGCCACCCCCTGCTCCACGG - Intronic
937596895 2:123684097-123684119 GAGCACCACCCCTTGCTCCACGG + Intergenic
937711800 2:124987448-124987470 GAGCGCCGCCCTCTGCTCCAGGG - Intergenic
937751378 2:125479196-125479218 CGGCGCCGCCCCCTGCTCTGGGG - Intergenic
938126029 2:128672160-128672182 GAGCACTGCCCCCTGCTCCACGG - Intergenic
938725981 2:134109384-134109406 GAGCGCAGCCCCCTGCTCCACGG - Intergenic
938931168 2:136088108-136088130 GAGCACCGCCCCCTGCTCCACGG - Intergenic
939003174 2:136758743-136758765 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
939085725 2:137716116-137716138 GGGCGCCGCCCCCTGCTCCATGG + Intergenic
939229808 2:139410663-139410685 GAGCGCCACCCCCTGCACCGGGG + Intergenic
939281798 2:140074102-140074124 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
939465179 2:142546383-142546405 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
939777312 2:146403729-146403751 GAGCACCACCCCCTGCTCCACGG - Intergenic
939869099 2:147507233-147507255 GAGCGCCACCCCATGCTCCACGG + Intergenic
939898962 2:147827182-147827204 GAGCACCGCCCCCTGCTCCACGG + Intergenic
939972500 2:148678438-148678460 AAGCGCCACCCCCTGCTCCACGG - Intronic
940145611 2:150542360-150542382 GAGTACTGCTCCCTGCTCCAGGG - Intergenic
940666657 2:156618072-156618094 GAGCACTGCCCCGTGCTCCACGG - Intergenic
941240132 2:163026598-163026620 GAGTGCCACCCCCTGCTCCACGG + Intergenic
941309294 2:163909846-163909868 GAGTGCTGCCCCCTGCTCCATGG + Intergenic
941309833 2:163913940-163913962 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
941476543 2:165957101-165957123 GGGCGCCGCCCCCTGCTCCACGG - Intergenic
941705824 2:168657476-168657498 GAGCTCCACCCCCTGCTCCACGG - Intronic
941712075 2:168724935-168724957 GAGTGCCACCCCCTGCTCCACGG - Intronic
941820839 2:169841856-169841878 GAGCACCACCCCCTACTCCACGG + Intronic
941878554 2:170459666-170459688 GGGCACCACCCCCTGCTCCATGG - Intronic
942299553 2:174548629-174548651 GAGCGCCGCCCACTGCTCTACGG - Intergenic
942540235 2:177008173-177008195 GAGTGCCGCCCCCTGCTCCAAGG + Intergenic
942867337 2:180691710-180691732 GAGCGCCGCTCCCTGCTCCACGG + Intergenic
943024253 2:182608720-182608742 CAGCGCCGCCCCCTGCTCCACGG + Intergenic
943106114 2:183546716-183546738 GAGCACCGCCCCCTGCTCCACGG - Intergenic
943680292 2:190760992-190761014 GAGCGCCACCCCCTGCTCCATGG - Intergenic
943790077 2:191921910-191921932 GAGCGCTGCCCCCTGCTCCATGG + Intergenic
943835205 2:192508291-192508313 AAGCGCCACCCCCTGCTCCATGG + Intergenic
943906079 2:193502503-193502525 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
943954999 2:194176687-194176709 GAGCACCACCCCCTGCTCCACGG + Intergenic
944058446 2:195547392-195547414 AAGCGCCACCCCCTGCTCCAGGG - Intergenic
944482838 2:200175061-200175083 AAGCGCCACCCCCTGCTCCAGGG + Intergenic
944728653 2:202497232-202497254 GAGTGCCGCCCCCTGCTCCACGG + Intronic
944729686 2:202503693-202503715 GAGTGCCGCCCCCTGCTCCACGG + Intronic
944843096 2:203642906-203642928 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
944857885 2:203785612-203785634 GAGCGCCACCCCCTGCTCCACGG - Intergenic
945069679 2:205977507-205977529 GAGCACTGCTCCCTGCTCCACGG + Intergenic
945575428 2:211524415-211524437 GAGCACCACCCCCTGCTCCACGG - Intronic
945664175 2:212721106-212721128 GGGCATCTCCCCCTGCTCCGCGG - Intergenic
945745828 2:213718814-213718836 GAGCACCACCCCCTACTCCACGG + Intronic
945869193 2:215208197-215208219 GGGTGCAGCCCCCTGCTCCGTGG + Intergenic
946152716 2:217787303-217787325 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
946354963 2:219178641-219178663 CGGCCCCGCCCCCTCCTCCGCGG - Intronic
946376543 2:219313099-219313121 GAGCGCCGCCCCCTTCTTCACGG + Intergenic
946923517 2:224603739-224603761 GAGCGCCACCCCCTGCTCCAGGG - Intergenic
946929197 2:224655626-224655648 GACGCCAGCCCCCTGCTCCGTGG + Intergenic
947026680 2:225744456-225744478 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
947103846 2:226648335-226648357 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
947171961 2:227320946-227320968 GGGCACCGCCCCCTGCTCCACGG + Intergenic
947412038 2:229851039-229851061 GAGCGCCGCCCCCTGCTCCAGGG + Intronic
947720472 2:232366663-232366685 GAGCGCCACCCCCTGCTCCATGG + Intergenic
947932010 2:233972506-233972528 GAGCGCCACCCCCTGCTCCATGG - Intronic
948115659 2:235493325-235493347 GAGCGCCGCTGCCTGCTCCACGG - Intergenic
948333624 2:237191167-237191189 GAGCACAGCCTGCTGCTCAGGGG - Intergenic
948567026 2:238893892-238893914 GAGCACCACCCCCTGCTAGCAGG - Intronic
1168806925 20:676928-676950 GAGCTCAGCCCCCTGCCCAGAGG + Intergenic
1169849237 20:10032001-10032023 GAGCACCACCCCCTGCTCCACGG + Intronic
1170246517 20:14226829-14226851 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1170806801 20:19639668-19639690 GAGCGCCGCCCCCTGCTCCTCGG - Intronic
1170989934 20:21292194-21292216 GAGTGCCACCCCCTGCTCCAGGG + Intergenic
1171973377 20:31578609-31578631 GAGCGCCGCCCCCTCCTCCATGG - Intergenic
1172363863 20:34333996-34334018 GAGCAGTGCCCCCAGCTCCTGGG + Intergenic
1172587077 20:36092579-36092601 GATCGCCGCCGCCTCCTCCGGGG + Intronic
1173195482 20:40910507-40910529 GAGCACCACCCCCTGCTCCACGG - Intergenic
1173195736 20:40911506-40911528 AAGCACCACCCCCTACTCCATGG + Intergenic
1173484428 20:43430009-43430031 GAGCTCCTCTCCCTGCTCCTTGG - Intergenic
1173601643 20:44299457-44299479 GAGCGCCGCCCCCTACTCCACGG + Intergenic
1173778814 20:45736214-45736236 GGGCACCGCCCCCTGCTCCATGG + Intergenic
1173831560 20:46092185-46092207 GAGCGCAGCCCCCTGCTCCAAGG + Intergenic
1174148919 20:48472398-48472420 CAGCACCACCCGCTCCTCCGGGG + Intergenic
1174162844 20:48564147-48564169 GAGTGCTGCCCCCTGCTCCACGG - Intergenic
1175254197 20:57629111-57629133 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1175946838 20:62562850-62562872 CAGCAGCGTCCCCTGCCCCGGGG - Intronic
1176017870 20:62945956-62945978 CAGAACTGTCCCCTGCTCCGTGG + Exonic
1176127371 20:63482067-63482089 CAGCACCGCCCCCTCCCCCCAGG + Intergenic
1176234667 20:64048794-64048816 GAGCCCGGCCTCCTGCTCCCGGG - Exonic
1176332254 21:5559689-5559711 GAGTGTCGCCCCCTGCTCCACGG - Intergenic
1176344790 21:5733550-5733572 GAGCTCCACCCCCTGTTCCATGG - Intergenic
1176351604 21:5854134-5854156 GAGCTCCACCCCCTGTTCCATGG - Intergenic
1176395503 21:6261262-6261284 GAGTGTCGCCCCCTGCTCCACGG + Intergenic
1176441654 21:6727842-6727864 GAGTGTCGCCCCCTGCTCCACGG - Intergenic
1176445176 21:6815542-6815564 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1176465916 21:7054911-7054933 GAGTGTCGCCCCCTGCTCCACGG - Intronic
1176489477 21:7436689-7436711 GAGTGTCGCCCCCTGCTCCACGG - Intergenic
1176500037 21:7590905-7590927 GAGCTCCACCCCCTGTTCCATGG + Intergenic
1176539111 21:8131620-8131642 GAGCTCCACCCCCTGTTCCATGG - Intergenic
1176558062 21:8314665-8314687 GAGCTCCACCCCCTGTTCCATGG - Intergenic
1176823343 21:13680575-13680597 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1176872205 21:14093007-14093029 GAGTGCCACCCCCTGCTCCATGG - Intergenic
1177318759 21:19493865-19493887 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1177565784 21:22818896-22818918 GAGCGCCGCCCCCTGCTTCATGG - Intergenic
1177795939 21:25778639-25778661 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1178327039 21:31654508-31654530 AAGCACCGCCCCCTGCTCTACGG + Intergenic
1178398790 21:32265654-32265676 GAGCACCACCCCCTGCTCCATGG + Intergenic
1178534715 21:33402727-33402749 GTGCACCGCCGCCGGCTCCAGGG + Intergenic
1178585598 21:33868355-33868377 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1179541330 21:42085058-42085080 GACCACCGATCCCTGCTCAGAGG - Intronic
1179646549 21:42779483-42779505 GGGCACCGGCCCCAGCTCCCAGG - Intergenic
1180481513 22:15760243-15760265 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1180740992 22:18053394-18053416 GAGCGCCGCCCCCTGCTCGATGG - Intergenic
1181077630 22:20392448-20392470 AAGCGCCGCCCCCTGCTCCACGG - Intergenic
1181558556 22:23686317-23686339 GAGCACAGCTCCCAGCTCAGGGG + Intergenic
1182278582 22:29205719-29205741 GAGCCCCACGCCCTGCGCCGCGG - Intergenic
1182337991 22:29598103-29598125 GAGCGCCGCTCCCTGCTCCAGGG - Intergenic
1183057409 22:35315414-35315436 GGGCACGGCCCTCTGCTCAGAGG + Intronic
1183487619 22:38097848-38097870 CAGCACCGCCCCTTGCCCTGTGG - Intronic
1183685285 22:39357922-39357944 GAGCACCACCCCCTGCTCCACGG + Intronic
1183990401 22:41593841-41593863 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1184584305 22:45437051-45437073 GAGCGCCGCCCCGTGCTCCACGG + Intergenic
1184747576 22:46465170-46465192 GAGCAGCGGCCCCTGCCCAGGGG + Intronic
1184786157 22:46673000-46673022 GAGCCCGGCCCCCAGCTGCGGGG + Intronic
1184906201 22:47488344-47488366 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1184962349 22:47940664-47940686 GAGCACCTCCCCTGGCTCAGCGG + Intergenic
1185038265 22:48490538-48490560 GAGCACCCTCCCCAGCGCCGAGG - Intronic
1185229071 22:49670239-49670261 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1185398586 22:50604685-50604707 CTGCTCCGCCGCCTGCTCCGAGG + Exonic
1203244061 22_KI270733v1_random:47975-47997 GAGCTCCACCCCCTGTTCCATGG - Intergenic
949259025 3:2083950-2083972 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
949292799 3:2485232-2485254 CAGCACCTCCCCCTGCTCCGCGG + Intronic
950203644 3:11061695-11061717 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
950207928 3:11094322-11094344 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
950256915 3:11513283-11513305 GAGCACCGCCCCCTGCTCCACGG - Intronic
950400924 3:12768831-12768853 GAGCGCTGCCCCCTGCTCCACGG - Intronic
950414019 3:12858128-12858150 AAGCACCGCCCCTTCCTCCTGGG + Intronic
950470209 3:13180039-13180061 GAGCACCGCACCCTGCTCCACGG + Intergenic
950545585 3:13636262-13636284 GAGCCAGGCCCCCTGCTGCGGGG + Intronic
950929441 3:16774039-16774061 AAGTGCCGCCCCCTGCTCCACGG + Intergenic
951146547 3:19234322-19234344 GAGCGGCGCCCCCTGCTCAACGG - Intronic
951185011 3:19702850-19702872 GGGCACCGCCCCCTGCTCCGTGG + Intergenic
951323152 3:21271658-21271680 GGGCACTGCCCCCTGCTCCGCGG - Intergenic
951332908 3:21387289-21387311 AAGCGCCACCCCCTGCTCCACGG - Intergenic
951415490 3:22417273-22417295 GAGCACCACCCCCTGCTCCATGG + Intergenic
951551830 3:23882569-23882591 GGGGACCACCCCCTGCTCCGCGG - Intronic
951951039 3:28200451-28200473 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
952011234 3:28903204-28903226 GAGCACCACCCGCTGCTCCGCGG - Intergenic
952076344 3:29701859-29701881 GAGCCCCACCCCCTGCTCCACGG + Intronic
952393759 3:32903116-32903138 GAATGCCGCCCCCTGCTCCACGG + Intergenic
952398279 3:32940005-32940027 GAATGCCGCCCCCTGCTCCAGGG + Intergenic
952453740 3:33453779-33453801 GAGCACTGCCCCCTGCTCCCCGG + Intergenic
952713358 3:36453625-36453647 GAGCGCCGCCCCCTGCTCCACGG + Intronic
952730693 3:36634230-36634252 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
952795296 3:37233341-37233363 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
953002939 3:38951474-38951496 AAGCACCGCCCTCTGCTCCACGG + Intergenic
953089878 3:39713638-39713660 GAGCGCCACCCCCTGCTCCACGG + Intergenic
953124464 3:40077965-40077987 GAGCGCCACCCCCTGCTCCACGG - Intronic
953522447 3:43656464-43656486 GAGTACCACCCCCTGCTCCATGG - Intronic
953674023 3:44986154-44986176 GAGCGCTGCCCCCTGCTCCACGG - Intronic
953714669 3:45307010-45307032 GAGCACCACCCCCTACTCCACGG + Intergenic
953907401 3:46875163-46875185 GAGCACCGTCCCGTGGTCCCTGG - Intronic
954041051 3:47887528-47887550 AAGCACCACCCCCTGCTCCACGG + Intronic
954226156 3:49182702-49182724 AAGCGCCGCCCCCTGCTCCATGG - Intronic
954230539 3:49213575-49213597 TAGCACTGCCCCCTGCTCCGTGG - Intronic
954620182 3:51990895-51990917 GAGCGCCGCCCCCCGCTCCACGG + Intergenic
955183401 3:56692203-56692225 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
955186473 3:56719255-56719277 GAGCACCACCCCCTGCTCCACGG + Intergenic
955219717 3:57013190-57013212 AGGCACTGCCCCCTGCTCCATGG + Intronic
955266412 3:57449383-57449405 GAGCACCACCCCCTGCTCCATGG - Intronic
955449528 3:59051180-59051202 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
956183890 3:66544682-66544704 GAGCGCCGCCCCCTGCTCTGCGG - Intergenic
956195782 3:66651850-66651872 GAGCACCGCCCCCTGCTCCACGG + Intergenic
956459273 3:69454751-69454773 GGGCACCACCCCCTGCTCCGTGG + Intronic
956632646 3:71331420-71331442 AAGCGCCGCTCCCTGCTCCACGG + Intronic
956987013 3:74712352-74712374 GAGCTCCGCCCCGTGCTCCACGG + Intergenic
957002224 3:74900014-74900036 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
957009135 3:74985163-74985185 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
957056124 3:75444472-75444494 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
957074125 3:75588077-75588099 GAGCACCACCCCCTGCTCCATGG + Intergenic
957209386 3:77240129-77240151 GGGCGCCGCCCCATGCTCCATGG - Intronic
957277515 3:78108711-78108733 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
957362128 3:79173645-79173667 GAGCACGGCCCCCTGCTCCACGG + Intronic
957419617 3:79951408-79951430 GAGCACCACCCCCTGCTCCACGG - Intergenic
957560120 3:81812046-81812068 GAGCGCCACCCCCTGCTCCACGG - Intergenic
957630986 3:82715649-82715671 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
957804857 3:85133898-85133920 GAGCGCCGCCCCCTGCTCCACGG - Intronic
957829964 3:85504713-85504735 GAGCGCCGCCCCCTGCTCCACGG - Intronic
957921871 3:86757924-86757946 GAGGGCCGCCCCCTGCTCCACGG + Intergenic
957995155 3:87679421-87679443 GAGCACCACCCCCTGCTCCACGG + Intergenic
958022684 3:88016011-88016033 GAGCGCCGCCCCCTGCTCCCGGG + Intergenic
958419917 3:93917907-93917929 GAGCCCCACCCCCTGCTCCAGGG + Intronic
958548542 3:95588575-95588597 GGGCACTGTCCCCTGCTCCCTGG - Intergenic
958810718 3:98858010-98858032 GAGCACCGCCCCCTGCTCCATGG - Intronic
960120872 3:113947885-113947907 GTGCCCCGCCCCCGGCGCCGGGG - Exonic
960149752 3:114238327-114238349 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
960199363 3:114812734-114812756 GAGCACCGCCCTCTGCTCCACGG - Intronic
960227487 3:115184925-115184947 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
960282187 3:115791885-115791907 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
960487357 3:118269987-118270009 GAGCACTGCCCCCTGCTCCATGG + Intergenic
960556402 3:119034995-119035017 GCGCGCCGCGCTCTGCTCCGCGG - Intronic
960669252 3:120140571-120140593 GAGCGCCGCCCCCTGCTCTGCGG + Intergenic
960761621 3:121078569-121078591 GAGCACCACCCCCTGCTCCATGG - Intronic
960868546 3:122227250-122227272 GAGCACCACCCCCTGCTCCATGG - Intronic
961268851 3:125672067-125672089 GGGCGCCACCCCCTGCTCTGCGG + Intergenic
961279966 3:125758663-125758685 GAGCACCGCCCCCTGCTCCATGG - Intergenic
961460511 3:127047000-127047022 GAGCACCACCCCCTGCTCCACGG + Intergenic
961688854 3:128653721-128653743 GAGCGCCGCCCCCTGCTCCAAGG + Intronic
961746676 3:129068345-129068367 AAGGGCCGCCCCCTGCTCCAGGG - Intergenic
961775174 3:129279148-129279170 GAGCACCGGCCCCCGCTCCGGGG + Intronic
961932271 3:130547102-130547124 GGGCGTCGCCCCCTGCTCTGTGG - Intergenic
962283702 3:134070298-134070320 GAGCACCACCCCCTGCTCCACGG - Intronic
962383717 3:134916393-134916415 GAGCACCGCCCCCTGCTCCACGG - Intronic
962398704 3:135039464-135039486 GAGCACCACCCCCTACTCCACGG - Intronic
962600452 3:136987625-136987647 GAGCGCCACCCCCTGCTCCACGG - Intronic
963397261 3:144750131-144750153 AAGCACCGCCCCCTGCTCCAGGG + Intergenic
963397941 3:144757218-144757240 GGGCACTGCCCCCTGCTCCATGG + Intergenic
963440457 3:145333701-145333723 GAGCGCTGCCCCCTGCTCCAGGG + Intergenic
963533309 3:146497612-146497634 GAGCACAGCCCCCTACTCCACGG + Intergenic
963554706 3:146772662-146772684 AAGTGCCGCCCCCTGCTCCGTGG + Intergenic
963589943 3:147245646-147245668 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
963742874 3:149097758-149097780 GAGTGCTGCCCCCTGCTCCAGGG - Intergenic
963862221 3:150323291-150323313 GAGCGCCACCCCCTGCTCCAAGG + Intergenic
964014360 3:151928242-151928264 GGGGCCCGCCCGCTGCTCCGGGG - Intergenic
964032371 3:152152741-152152763 GAGCGCCACCCCCTGCTCCACGG + Intergenic
964117925 3:153155786-153155808 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
964129315 3:153269044-153269066 GGGCGTCGCCCCCTGCTCCGCGG + Intergenic
964138301 3:153369789-153369811 GGGCACCGCCCCCTGCTCCATGG - Intergenic
964139172 3:153378373-153378395 GAGCACCACCCCCTGCTCCACGG - Intergenic
964198190 3:154088294-154088316 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
964376399 3:156052293-156052315 CAGCGCCGCCCTCTGCTCCACGG + Intronic
964378560 3:156073439-156073461 GAGTGCCGCCCCCTGCTCCACGG + Intronic
964381139 3:156099747-156099769 GAGCACAGCCCCCTGCTCCACGG + Intronic
964393736 3:156223948-156223970 GAGCGCTGCCCCCTGCTCCACGG - Intronic
964444051 3:156740900-156740922 GAGTGCCACCCCCTGCTCCATGG + Intergenic
964977804 3:162640394-162640416 AAGCACCGCCCCCTGCTCCACGG + Intergenic
964982460 3:162702957-162702979 GAGAAGCACCCCCTGCTCCATGG - Intergenic
964983108 3:162710545-162710567 AAGCACCGCCCCCTGCTCCATGG - Intergenic
965003569 3:162987643-162987665 GAGCACCGTCCCCTGCTCCAAGG + Intergenic
965078042 3:164003291-164003313 GAGCACCACCCCCTGCTCCAGGG + Intergenic
965109374 3:164401927-164401949 GAGCGTCGCCCCCTGCTCCACGG - Intergenic
965200298 3:165649354-165649376 GAGCGCCACCCCCTGCTCCATGG - Intergenic
965220166 3:165918483-165918505 GAGCGCCGCCCCCTGCTCCCTGG - Intergenic
965245192 3:166258505-166258527 GAACACCACCCTCTGCTCCATGG - Intergenic
965256825 3:166424256-166424278 GAGCACTGCCCCCTGCTGCACGG + Intergenic
965288091 3:166843135-166843157 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
965587025 3:170327747-170327769 GGGCACTGCCCCCTGCTCCATGG + Intergenic
965652415 3:170947546-170947568 GGGCACTGCCCCTTGCTCTGCGG + Intergenic
965753179 3:171998908-171998930 GAGCACCACCCCTTGCTCCACGG - Intergenic
965837420 3:172867105-172867127 GAGCACCGCCCCCTGCTCCACGG + Intergenic
965943432 3:174212009-174212031 GAACACCACCCCCTGCTCCATGG - Intronic
966076112 3:175937695-175937717 AAGCGCCGCCCCCTGCTCCACGG + Intergenic
966096738 3:176213453-176213475 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
966108163 3:176362262-176362284 CAGCGCCGCCCCCTGCTCCGCGG - Intergenic
966182984 3:177203912-177203934 GGGTGCCGCCCCCTGCTCTGCGG - Intergenic
966246029 3:177808980-177809002 GAGCACCGCCCCCTGCTCCACGG - Intergenic
966372380 3:179263090-179263112 GAGCGCTGCCCCCTGCTCCACGG - Intronic
966725053 3:183101220-183101242 GAGCGCCACCCCCTGCTCCACGG + Intronic
967234056 3:187367613-187367635 GAGTGCCACCCCCTGCTCCATGG - Intergenic
967448551 3:189596447-189596469 AAGCGCCACCCCCTGCTCCACGG + Intergenic
967499105 3:190177086-190177108 AAGCGCCACCCCCTGCTCCACGG - Intergenic
967594869 3:191317050-191317072 GGGCACCACCCCCTGCTCCAAGG - Intronic
967718405 3:192789355-192789377 GAGCGCCGCGCCCTGCTCCACGG + Intergenic
967923785 3:194631346-194631368 GAGCACCACCCTCTGCTGAGTGG - Intronic
968469723 4:773851-773873 GAGCACTGCCCCGTGCTCCACGG + Intergenic
968565277 4:1309411-1309433 AAGCACCGCCTCCTCTTCCGGGG - Intronic
968716209 4:2161590-2161612 GAGCGCCGCCCCCTGCTCCATGG + Intronic
968959954 4:3738379-3738401 GAGCAGGGCCCACTCCTCCGTGG - Intergenic
968976340 4:3824144-3824166 AAGCAGCGGCCCCTGCTCCTGGG + Intergenic
968998930 4:3964753-3964775 GGACACTGCCCCCTGCTCCAGGG - Intergenic
969017744 4:4115677-4115699 GAGCACCGCCCCCTGCTCCACGG + Intergenic
969303108 4:6309073-6309095 AAGCGCCGCCCCCTGCTCCGCGG - Intergenic
969362403 4:6673047-6673069 GAGCACCACCCCCTGCTCCACGG + Intergenic
969440789 4:7215452-7215474 GAGCGCGACCCCCTGCTCCACGG + Intronic
969654928 4:8491447-8491469 GAGCACCACCCCCTGCTCCACGG - Intronic
969755068 4:9143880-9143902 GAGCACCGCCGCCTGCTGCAGGG + Intergenic
969795445 4:9524498-9524520 GAGCACCACCCCCTGCTCCATGG - Intergenic
969814971 4:9680163-9680185 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
970182640 4:13415706-13415728 GAGCACCATCCCCTGCTCTACGG + Intronic
970391265 4:15615237-15615259 GAGCACTACCCCCTGCTCCACGG + Intronic
970408595 4:15786766-15786788 GAGCACCGCGCCCTGCTCCCTGG - Intronic
970615710 4:17766846-17766868 GAGCGCTGCCCCCTGCTCTGTGG - Intronic
970649278 4:18159307-18159329 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
970691940 4:18630608-18630630 GGGCACCGCCCCCTGCTCTGCGG - Intergenic
970803578 4:20004338-20004360 AAGCGCCGCCTCCTGCTCCAGGG + Intergenic
970817835 4:20179048-20179070 AAGCGCCGCCCCCTGCTCCATGG - Intergenic
971043304 4:22778645-22778667 AGGCACCGCCCCCTGCTCCATGG - Intergenic
971043321 4:22778695-22778717 GAGCCCCGCCCCCCGCTGTGGGG - Intergenic
971280487 4:25239279-25239301 AAGCGCCACCCCCTGCTCCATGG - Intronic
971281633 4:25246661-25246683 AAGCACCACCCTCTGCTCCATGG - Intronic
971377060 4:26064007-26064029 GAGCGCCGCCCCCTGCTGCACGG - Intergenic
971552990 4:27978372-27978394 GAGCACCACCCCCTGCTCCACGG - Intergenic
971563610 4:28113101-28113123 GAGCACCGCCCCCTGCTCCACGG + Intergenic
971564146 4:28117180-28117202 GGGCGCCGCCCCCAGCTCCAGGG - Intergenic
971635157 4:29047850-29047872 GAGTGCTGCCCCCTGCTCCAGGG + Intergenic
971639871 4:29117677-29117699 GAGCGCCGTCCCCTGCTCCACGG + Intergenic
971792303 4:31185006-31185028 GAGTGCCGCCCCCTGCTTCATGG - Intergenic
971812001 4:31438975-31438997 GAGCACCACCCCCTGCTCCACGG + Intergenic
971852155 4:31996741-31996763 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
971905143 4:32716262-32716284 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
972022741 4:34335678-34335700 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
972344692 4:38182893-38182915 GAGCTCCGCCCCCTGCTCTGCGG + Intergenic
972505737 4:39718551-39718573 GAGCATTGTCCCCTGCTCCACGG - Intronic
972890514 4:43551535-43551557 GAGCACCGCCCCCTGCTCCGCGG + Intergenic
972900176 4:43672681-43672703 GAGCACCACCCCCTGCTCCAAGG + Intergenic
973037150 4:45420473-45420495 GAGCATCGCCCCCTGCTCCACGG + Intergenic
973039891 4:45457154-45457176 GAGTGCCGCCCCCTGCTCCATGG - Intergenic
973041759 4:45477388-45477410 GAGCGCCGCGCCCTGCTCCACGG - Intergenic
973048622 4:45567376-45567398 GAGCCCCACCCCCTGCTCCATGG + Intergenic
973135300 4:46699176-46699198 GGGCACTACCCCCTGCTCCATGG + Intergenic
973144219 4:46804867-46804889 GTGCACAGCCCCCTGCTCCACGG - Intronic
973308128 4:48675664-48675686 GAGCACCACTCCCTGCTCCACGG + Intronic
973587714 4:52409783-52409805 GAGCACCACCCCCTGCTCCAGGG - Intergenic
973817637 4:54632859-54632881 GAGCGCTGACCCCTGCTCCACGG + Intergenic
973878157 4:55241779-55241801 GAGCACCGCCCCCTGCTCCACGG + Intergenic
974147468 4:57965748-57965770 GAGCACCACCCCCTGCTCCACGG + Intergenic
974186836 4:58457252-58457274 GGGCACCGCCCCATGCTCTGTGG + Intergenic
974299197 4:60042259-60042281 GGGCACTGCCCCCTGCTCCATGG - Intergenic
974484737 4:62491934-62491956 GAGCGCCACCCCCTGCTCCACGG - Intergenic
974590545 4:63942919-63942941 GAGCCCCGGCCCCTGCTCCCCGG - Intergenic
974641698 4:64640510-64640532 GAGCACTACCCCCTGCTCCATGG - Intergenic
974781697 4:66561529-66561551 GAGCACCGCCCCCTGCTCCACGG - Intergenic
974827809 4:67152203-67152225 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
974839291 4:67282861-67282883 AGGCACTGCCCCCTGCTCCATGG - Intergenic
974839742 4:67286733-67286755 GGGTGCCGCCCCCTGCTCTGTGG - Intergenic
974992823 4:69115281-69115303 GAGTGCCGCCCCCTGCTCAAGGG - Intronic
975055449 4:69924214-69924236 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
975160762 4:71121266-71121288 GGGCACTGCCCCCTGCTCCGTGG + Intergenic
975439902 4:74399101-74399123 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
975595140 4:76043332-76043354 GAGTGCCACCCCCTGCTCCACGG - Intronic
975870774 4:78776363-78776385 GGGCCCCGCCGCCCGCTCCGCGG - Exonic
975994979 4:80303118-80303140 GAGCGCCGCCCCCTGTTCCACGG + Intronic
976520581 4:86021644-86021666 GAGCACCACCCCCTGCTCCATGG - Intronic
976646820 4:87395983-87396005 GAGCACCAACCCCTGCTCCACGG - Intergenic
976736256 4:88313240-88313262 CAGCACCGCCCCCTGCTCCAGGG - Intergenic
976846111 4:89490326-89490348 GAGCGCTGCCCCCGGCTCCACGG + Intergenic
976980246 4:91218007-91218029 AAGCACCACCCCCTGCTCCACGG - Intronic
977206574 4:94170168-94170190 GAGCGCCGCCCCCTGCTCAATGG + Intergenic
977416704 4:96742842-96742864 GAGCGCCGTCCCCTGCTCCGTGG + Intergenic
977507741 4:97923344-97923366 AAGTGCCGCCCCCTGCTCCAGGG + Intronic
977606873 4:98993518-98993540 GAGGGCCACCCCCTGCTCCAGGG - Intergenic
977717302 4:100196557-100196579 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
977750916 4:100608802-100608824 GAGCACCACCCCCTGCTCCATGG - Intronic
977885720 4:102250331-102250353 GATTGCCGCCCCCTGCTCCATGG - Intergenic
977906528 4:102483452-102483474 GAGCACCGCCCCCTGCTCCATGG + Intergenic
978030649 4:103937118-103937140 GAGCGTCGCTCCCTGCTCCACGG + Intergenic
978080299 4:104582304-104582326 GAGCGCCACCCCCTGCTCCACGG + Intergenic
978241839 4:106525382-106525404 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
978285632 4:107073518-107073540 GAGCGCTACCCCCTGCTCCATGG + Intronic
978748615 4:112222754-112222776 AGGCGCTGCCCCCTGCTCCGTGG + Intergenic
978917932 4:114148617-114148639 GAGCACTGCCCCCTGCTCCAGGG - Intergenic
978997996 4:115179468-115179490 AAGCGCCACCCCCTGCTCCGTGG - Intergenic
978999530 4:115200231-115200253 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
979033178 4:115678538-115678560 GGGCACCGCTCCCTGCTCTGCGG - Intergenic
979290768 4:118977087-118977109 GAGCACCACCCCCTGCTCCACGG - Intronic
979445637 4:120808648-120808670 GAGTGCCTCCCCCTGCTCCATGG - Intronic
979688640 4:123538240-123538262 GAGTGCCACCCCCTGCTCCACGG + Intergenic
979755913 4:124339335-124339357 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
979822598 4:125192226-125192248 AGGCACAGCCCCCTGCTCCAGGG + Intergenic
979857464 4:125651800-125651822 AAGCACTGCCTCCTGCTCCACGG - Intergenic
979899657 4:126201328-126201350 GAGCGCCGCCGCCTGCTCCAGGG - Intergenic
980043329 4:127964274-127964296 GAGCGCCGCTCCCTACTCCACGG - Intronic
980051881 4:128047596-128047618 GAGCGCCGCCCCCTGCTCCCCGG - Intergenic
980115254 4:128672942-128672964 GAGCGCTGCCCCCTGCTCCATGG + Intergenic
980228031 4:130013103-130013125 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
980230208 4:130038583-130038605 AAGCGCCGCCCCCTGCTCCACGG - Intergenic
980470180 4:133240444-133240466 GAGCACCACCCCCTGCTCCACGG - Intergenic
980815606 4:137942394-137942416 GAGCGCCACCCCCTGCTCCACGG + Intergenic
980824065 4:138052982-138053004 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
981146674 4:141333055-141333077 GAGCGCCATCCCCTGCTCCACGG - Intergenic
981176541 4:141689895-141689917 GAGCACCGCCCCCTGCTCCACGG - Intronic
981275863 4:142897820-142897842 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
981280645 4:142954584-142954606 GGGCGCCACCCCCTGCTCCGCGG + Intergenic
982408276 4:155044626-155044648 GAGCACCACCCCCTGCTCCAAGG + Intergenic
982647710 4:158044450-158044472 GAGCGCCGCTTCCTGCTCCAAGG + Intergenic
982692816 4:158567224-158567246 GACCATGGCCCCCTGCTCCAGGG + Intronic
982728236 4:158928025-158928047 GAGCGCCGCCCCCTGCTCCACGG + Intronic
982814533 4:159869069-159869091 GAGCGCCACCCCCTGCTCCACGG - Intergenic
982863440 4:160482092-160482114 GAGGGCCGCCCCCTGCTCCACGG + Intergenic
982921316 4:161277551-161277573 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
983026145 4:162739864-162739886 GAGTGCCACCCCCTGCTCCACGG + Intergenic
983060384 4:163153169-163153191 GAATACCACCCCCTGCTCCACGG + Intronic
983064039 4:163189752-163189774 GAGCGCCACCCCCTGCTCCAGGG - Intergenic
983134982 4:164068677-164068699 GAGTGCCGCCCCCTGCTCCATGG + Intronic
983230612 4:165125976-165125998 AAGCGCCGCCCCCTGCTCCATGG - Intronic
983425754 4:167581879-167581901 GGGCGCCACCCCCTGCTCCGTGG + Intergenic
983513484 4:168632974-168632996 GAGGACAGCCCCCTTCTCAGGGG - Intronic
983553007 4:169035872-169035894 GAGCACCACCCCCTGCTCCATGG - Intergenic
983734761 4:171043481-171043503 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
983752891 4:171298601-171298623 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
983834190 4:172369510-172369532 GGGTGCCACCCCCTGCTCCGCGG - Intronic
983835345 4:172377574-172377596 GGGCACCGGCCCCTGCTCCACGG - Intronic
984069336 4:175092437-175092459 GAGTGCTGCCCCCTGCTCCGCGG + Intergenic
984192787 4:176625202-176625224 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
984265709 4:177495915-177495937 GAGCGCCACCCCCTGCTCCACGG + Intergenic
984728698 4:183045389-183045411 AAGCGCTGCCCCCTGCTCCACGG + Intergenic
984770615 4:183433468-183433490 GAGCACCGCCCCCTGCTCCATGG + Intergenic
984776063 4:183482729-183482751 GAGCTCCACCCCCTGCTCCAGGG - Intergenic
984862532 4:184253264-184253286 CGGCACCGCCCCCTGCTCAGGGG + Intergenic
984918154 4:184741527-184741549 AAGCATCACCCCCTGCTCTGTGG + Intergenic
984948668 4:184990124-184990146 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
985087148 4:186324907-186324929 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
985195065 4:187420659-187420681 GAGCACCACCCCCTGCTCCATGG - Intergenic
985203298 4:187505954-187505976 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
985269350 4:188179283-188179305 GAGCGCTGTCCCCTGCTCCATGG + Intergenic
985366447 4:189236629-189236651 AAGCACCAACCCCTGCTCCACGG + Intergenic
985403556 4:189615255-189615277 GAGCGCCGCCCCCTGCTCGATGG - Intergenic
985403822 4:189616683-189616705 GAGCGCCACCCCCTGCTCCATGG - Intergenic
985590930 5:764682-764704 GAGCACCGTCCCCTGCTCTGCGG + Intronic
985680099 5:1251692-1251714 GAGCAGCGGCCTCTGCTCCTGGG + Intergenic
986121185 5:4837857-4837879 GAGAGCTGCCCCCTGCTCCACGG + Intergenic
986626223 5:9725651-9725673 GAGCACCGCCCCCTGCTCCACGG + Intergenic
986698045 5:10375480-10375502 GAGCACCACCCTCTGCTCCACGG + Intronic
986912335 5:12573981-12574003 GAGCGCCACCCCCTGCTCCACGG - Intergenic
986919074 5:12662227-12662249 GGGCGCCGCCCCCTGCTCCGTGG + Intergenic
987146201 5:14993843-14993865 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
987156713 5:15096552-15096574 GAGCACAGCCCCCTGCTCCAGGG - Intergenic
987283779 5:16436504-16436526 GAGCACCACCCCCTGCTCCACGG + Intergenic
987315342 5:16718275-16718297 GAGCACCGCCCCCTGCTCCACGG + Intronic
987355888 5:17062513-17062535 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
987383961 5:17311810-17311832 GAGCGCCACCCCCTGCTCCACGG - Intergenic
987476634 5:18399697-18399719 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
987543881 5:19288068-19288090 GAGCGCCGCCCTCTGCTCCACGG + Intergenic
987876998 5:23691448-23691470 GAGCACCACCCCCTGCTCCACGG + Intergenic
987896339 5:23951620-23951642 GAGCGCCGCCCCCTGCTCCAGGG + Exonic
988073554 5:26324784-26324806 GAGAGCAGCCCCCTGCTCCATGG + Intergenic
988086939 5:26485317-26485339 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
988132207 5:27120223-27120245 GAGCACCACCCCCTGCTCCACGG + Intronic
988155003 5:27439487-27439509 GAGCACCACCCCCTGCTCCATGG - Intergenic
988201734 5:28077705-28077727 GAGCCCCGCCCCCTGCTCCATGG - Intergenic
988291718 5:29296528-29296550 GAGCGTCGCCCCCTGCTCCTCGG - Intergenic
988500193 5:31777439-31777461 GGGCGCCGCCCCCTGCTCCGTGG + Intronic
988684685 5:33515425-33515447 GAGCGCGGCCCACTGCTCCAGGG - Intergenic
988883644 5:35531951-35531973 GAGCACCGCCCCCTGCTCCATGG + Intergenic
988915849 5:35892904-35892926 GAGCACCACCCCCTGCTCCACGG - Intergenic
989346844 5:40438983-40439005 GAGCACCACCCCCTGCTCCACGG + Intergenic
989559733 5:42836692-42836714 GGGCGCTGCCCCCTGCTCCACGG + Intronic
989750185 5:44883966-44883988 GAGCGCCACCCCTTGCTCCGCGG - Intergenic
989950619 5:50293171-50293193 GAGCGCTGCCCCCTGCTCCAGGG + Intergenic
989957975 5:50377154-50377176 GATCGCCACCCCCTGCTCCATGG + Intergenic
990461571 5:56035813-56035835 GTGCACCACCCCCTACTCCACGG + Intergenic
990490116 5:56295648-56295670 TAGCACGGCTCCCTGCTCCATGG + Intergenic
990512097 5:56498696-56498718 GAGCACCACCCCCTGCTCCATGG - Intergenic
990665671 5:58069174-58069196 AAGCGCTGCCCCCTGCTCTGTGG - Intergenic
990869517 5:60415739-60415761 AAGCGCTGCCCCCTGCTCCAGGG + Intronic
991214995 5:64150396-64150418 GAGTGCTGCCCCCTGCTCCATGG + Intergenic
991330187 5:65485510-65485532 GAGCACTGCCCGCTGCTCCAGGG - Intergenic
991567512 5:68020439-68020461 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
991657842 5:68921189-68921211 GAGCACAGCTCCCTACTCCACGG + Intergenic
992048916 5:72925814-72925836 GGGTGCCGCCCCCTGCTCCGCGG + Intergenic
992296785 5:75334009-75334031 GAGCACCACCCCCTGCTCCACGG + Intergenic
992802939 5:80310027-80310049 GGGCACCGCGCCCTGCTCTGCGG - Intergenic
993031921 5:82715013-82715035 AAGCACCGCCCCCTGCTCCAGGG + Intergenic
993202166 5:84830354-84830376 GGGCATCGCCCCCTGCTCCACGG - Intergenic
993678558 5:90847554-90847576 AAGCACCTCCCCCTGCTCCAGGG - Intronic
993822086 5:92631655-92631677 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
993879766 5:93348452-93348474 GCGCACCGTCCGCTGCTCCGAGG + Intergenic
994096389 5:95851490-95851512 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
994230014 5:97301472-97301494 GAGCACTGCCCCCTGCTCCACGG + Intergenic
994254747 5:97580031-97580053 TAGCGCCACCCCCTGCTCCACGG - Intergenic
994507165 5:100657086-100657108 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
994509791 5:100688905-100688927 GAGCGCCGGTCCCTGCTCCAGGG - Intergenic
994620394 5:102155264-102155286 AAGCACCGCCCCCTGCTCCACGG + Intergenic
994647718 5:102491428-102491450 GAGTGCCGCCCCCTGCTCCACGG - Intronic
994701652 5:103142071-103142093 GAGCACCACCCCCTGCTCCACGG - Intronic
994932396 5:106206126-106206148 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
995199409 5:109410005-109410027 GAGTCCCGCCCCTTGCGCCGCGG + Intergenic
995206614 5:109487886-109487908 AAGCGCCGCCCCCTGCTCCTCGG - Intergenic
995326373 5:110894064-110894086 GAGCACCGCCCCCTGCTCCAAGG - Intergenic
995388285 5:111612188-111612210 TAGCGCCACCCCCTGCTCCATGG - Intergenic
995529185 5:113075359-113075381 GGGTGCCGCCCCCTGCTCTGAGG + Intronic
995568723 5:113457467-113457489 GAGCACAGCCCCCTGCTCCACGG + Intronic
995596407 5:113753155-113753177 GAGCACCACCCCCTGCTCCAAGG - Intergenic
995656555 5:114433004-114433026 GAGCGCCACCCCCTGCTCCACGG + Intronic
995679823 5:114704325-114704347 GAGCACCACCCCCTACTCCACGG - Intergenic
995700449 5:114929230-114929252 GAGCGCTGCCCCCTGCTCTAAGG + Intergenic
995920446 5:117304986-117305008 GAGCACCACCCCCTACTCCACGG + Intergenic
995988387 5:118207985-118208007 GAGTGCTGCCCCCTGCTCTGCGG - Intergenic
996107092 5:119517428-119517450 GAGTGCCACCCCCTGCTCCACGG + Intronic
996435741 5:123430873-123430895 GAGCGCCACCCCCTGCTCCACGG + Intergenic
996478653 5:123949226-123949248 GAGTGCCACCCCCTGCTCCGTGG - Intergenic
997352261 5:133239283-133239305 GAGCACTGCTCCCTGCTCCAGGG + Intronic
997375553 5:133394674-133394696 GAGCGCCGCCACCTGCTCCGTGG + Intronic
997600844 5:135137429-135137451 GAGCTCCGGGCCCTGCTCTGAGG + Intronic
997760609 5:136444538-136444560 GAGCACCGCCCCCTGCTCCATGG + Intergenic
998117587 5:139549667-139549689 GGGCGCCACCCCCTGCTCCGCGG + Intronic
998366813 5:141637414-141637436 GCGCTCCGCCCCCTGGTCCTGGG + Exonic
999348590 5:150845750-150845772 GAGCGCCGCTCCCTGCTCCACGG + Intergenic
999406230 5:151309516-151309538 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
999855235 5:155586789-155586811 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1000066084 5:157694162-157694184 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1000085919 5:157887167-157887189 GGGCACTGCCCCCTGCTCCATGG + Intergenic
1000212400 5:159119452-159119474 GAGCACCGCTCCCTGCTCCACGG + Intergenic
1000329139 5:160193933-160193955 GAGCGCCGCCCCCTGCCCCACGG - Intronic
1000891767 5:166810232-166810254 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1000996928 5:167968878-167968900 TAGCACCGCCCCTTGCACAGGGG - Intronic
1001636493 5:173213755-173213777 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1001787258 5:174424527-174424549 GAGTACCCCCACCTGCTCCCCGG + Intergenic
1001843612 5:174901842-174901864 AAGCACCTCCCCCTGCTCCATGG + Intergenic
1002556496 5:180045991-180046013 GAGCGCTGCCCCCTGCTCCACGG - Intronic
1002612832 5:180432489-180432511 CAGGTGCGCCCCCTGCTCCGCGG + Intergenic
1002616502 5:180459498-180459520 GAGCGCCACCCCGTGCTCCATGG + Intergenic
1002789330 6:426237-426259 GAGCGCCGCCCCGTGCTCCACGG - Intergenic
1002790695 6:435614-435636 GAGCCCCGCTCCCTGCTCCAGGG - Intergenic
1002793250 6:450292-450314 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
1002817749 6:694905-694927 GAGCGCTGCCCCCTGCTTCACGG + Intergenic
1002906979 6:1457007-1457029 GAGCGCCACCCCCTGCTCTACGG - Intergenic
1003061850 6:2870105-2870127 GGGCGCCGCCCACTGCTCCGCGG - Intergenic
1003069721 6:2936142-2936164 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1003070261 6:2939917-2939939 GAACACCACCCCCTACTCCATGG + Intergenic
1003087041 6:3068645-3068667 GCTCACCGCGCCCTTCTCCGTGG - Exonic
1003170800 6:3720801-3720823 GAGCACCACCCCCTGCTCCACGG - Intergenic
1003176908 6:3758441-3758463 GAGCGCCGCGCCCTGCTCTACGG + Intergenic
1003178524 6:3771915-3771937 GAGCACCGCACCCTGCTCCACGG + Intergenic
1003224419 6:4191324-4191346 GAGCACTGCTCCCTGCTCCATGG - Intergenic
1003284806 6:4725367-4725389 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1003489185 6:6606510-6606532 GAGCGCCGCCCCCTGCTACACGG - Intronic
1003506638 6:6745753-6745775 AAGCGCCGCTCCCTGCTCCACGG - Intergenic
1003508788 6:6762517-6762539 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1003531425 6:6940413-6940435 GAGCGCCGGCCTCTGCTCCACGG + Intergenic
1003532917 6:6952656-6952678 GGGCGCCGCCTACTGCTCCGCGG + Intergenic
1003717616 6:8665816-8665838 GAGCACCACCCCCTGCTCCACGG - Intergenic
1003717751 6:8666292-8666314 GAGCACCACCCCCTGCTCCACGG + Intergenic
1003736945 6:8887489-8887511 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1003748062 6:9024590-9024612 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1003770104 6:9290480-9290502 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
1003836168 6:10074746-10074768 GAGCGCCACCCCCTGCTCCACGG - Intronic
1003845777 6:10172048-10172070 GAGCGCCACCCCCTGCTCCACGG + Intronic
1003862843 6:10337735-10337757 GAGCACCACCCCCTGCTCCACGG + Intergenic
1003896976 6:10617096-10617118 GAGCACCCCTCCCTGCTCCATGG - Intronic
1003983923 6:11417033-11417055 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
1004045315 6:12017959-12017981 GAGCGCTGCCCCCTGTTCCTAGG - Intronic
1004053102 6:12108426-12108448 GAGCGCCGCCCCCTGCTCCATGG - Intronic
1004196537 6:13511072-13511094 GAGCGCCGCCCCCTGCTCCGTGG - Intergenic
1004200313 6:13541864-13541886 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1004217630 6:13717075-13717097 AAGCGCCGCCCCTTGCTCCGTGG + Intergenic
1004338176 6:14783640-14783662 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1004406875 6:15340957-15340979 TAGCACCGCTTCCTGCTTCGAGG - Intronic
1004452342 6:15758794-15758816 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1004483196 6:16040426-16040448 GGGTGCTGCCCCCTGCTCCGCGG - Intergenic
1004497728 6:16180757-16180779 GAGCGCCGCCCCCTGCTCTCCGG - Intergenic
1004499627 6:16198137-16198159 GAGCGCCGCCTCCTGCTCCACGG - Intergenic
1004501945 6:16217150-16217172 AAGCACAGCCCCCTGCCCCACGG + Intergenic
1004503138 6:16226907-16226929 GAGTGCCGCCCCCTGCTACACGG - Intergenic
1004511696 6:16288579-16288601 GAGCGCCGCCCCCTGCTCCAAGG + Intronic
1004647954 6:17580943-17580965 GATCGCCGCCCCCTGCTCCACGG + Intergenic
1004663361 6:17729078-17729100 AAGCGCCGCCCCCTGCTGCGCGG + Intergenic
1004665484 6:17745344-17745366 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1004861341 6:19807047-19807069 GAGCACTGCCCCCTGCTCCATGG - Intergenic
1004866003 6:19854463-19854485 GAGCGCCGCCCCCTGCTGCACGG - Intergenic
1004906255 6:20239340-20239362 GAGCGCTGCCCCCTGCTCCAGGG + Intergenic
1004912673 6:20301576-20301598 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1004914485 6:20319203-20319225 GAGCGCCGCTCCCTGCTCCATGG + Intergenic
1005042225 6:21609936-21609958 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1005114223 6:22318462-22318484 GGGCACCACCCCCTGCTGCATGG - Intergenic
1005561478 6:27045556-27045578 GAGCGCCGCCCCCTACTCCACGG + Intergenic
1005596161 6:27381104-27381126 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1005600818 6:27424864-27424886 GAGCGCCACCCCCTGTTCCACGG - Intergenic
1005707397 6:28469390-28469412 GAGCGCCGCCCGCTGCTCCACGG - Intergenic
1005749032 6:28866520-28866542 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1005749873 6:28872628-28872650 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1005751258 6:28885171-28885193 GGGCGCCGCCCCCTGCTCCGCGG - Intergenic
1005758846 6:28949830-28949852 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1005759854 6:28958168-28958190 GAGCACCACCCCCTACTCCATGG + Intergenic
1005978185 6:30816334-30816356 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1006005824 6:31000789-31000811 GAGTGCCACCCCCTGCTCCAGGG + Intergenic
1006008357 6:31021044-31021066 GAGCGCCGCCCCCTGCTCCAGGG + Intronic
1006033684 6:31195785-31195807 GAGCACCACCCCCTGCTCCACGG + Intergenic
1006071201 6:31498967-31498989 GAGATCCGCCCCCAGCACCGGGG - Intronic
1006127998 6:31852339-31852361 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1006227018 6:32547960-32547982 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1006348508 6:33502978-33503000 GAACACTGTCCCCTCCTCCGTGG + Intergenic
1006351045 6:33521546-33521568 GGGCGCCGCCCCTTGCTCTGCGG - Intergenic
1006352693 6:33532714-33532736 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1006477881 6:34269350-34269372 GAGCACCACCCCCTGCTCCACGG + Intergenic
1006602680 6:35236398-35236420 GTGCCCCTCCCCCTGCTCCTGGG + Intronic
1006696057 6:35931594-35931616 GAGTGCCGCCCCCTGCTCCAGGG + Intergenic
1006978316 6:38124365-38124387 GAGCGCCGCCCCCTGCTCCATGG - Intronic
1007631580 6:43275887-43275909 GAGCCCCGCCCCCTCCCCCACGG - Intronic
1007738773 6:43998380-43998402 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1008005542 6:46405803-46405825 GAGCACCACCCCCTGCTCCACGG - Intronic
1008038836 6:46774922-46774944 AAGCCCCGCCCCCTGCTCCACGG + Intergenic
1008230776 6:48983467-48983489 GAGCACTGTCCCCTGTTCCATGG - Intergenic
1008254117 6:49275767-49275789 GAGTGCCGCCCCCTGCTCCATGG + Intergenic
1008270137 6:49481863-49481885 GAGTGCTGCCCCCTGCTCCATGG - Intronic
1008284291 6:49629586-49629608 GAACGCCACCCCCTGCTCCACGG - Intronic
1008567875 6:52786808-52786830 GAGCGCTGCCCCCTGCTCCAGGG + Intergenic
1008572478 6:52829220-52829242 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
1008587478 6:52962670-52962692 GGGTGCTGCCCCCTGCTCCGCGG - Intergenic
1008631070 6:53363486-53363508 GAGCGCTGCCCCTTGCTCCGTGG - Intergenic
1008771046 6:54979560-54979582 GAGCACCACCCCCTGCTCCACGG + Intergenic
1009402650 6:63275020-63275042 GAGGGCCGCCCCCTGCTCCAAGG - Intergenic
1009587697 6:65627865-65627887 GAGCACCACCCCCTGCTCTACGG + Intronic
1009800763 6:68533714-68533736 GAGTGCCGCTCCCTGCTCCAGGG + Intergenic
1009872317 6:69467534-69467556 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1010199265 6:73268910-73268932 GAGCACCACCCCCTGCTCCATGG - Intronic
1010617433 6:78030126-78030148 GAATGCCGCCCCCTGCTCCACGG + Intergenic
1011129281 6:84037515-84037537 GGGCGCCGCCCCCTGCTCCATGG - Intronic
1011143741 6:84189692-84189714 GAGCACCACCCCCTGCTCCACGG + Intronic
1011178160 6:84587710-84587732 GAGCACCACCCCCTGCTCCACGG + Intergenic
1011246570 6:85326292-85326314 GAATGCCGCCCCCTGCTCCAGGG + Intergenic
1011277441 6:85643766-85643788 GGCCCCCGCCCCCGGCTCCGCGG + Intronic
1011338309 6:86284855-86284877 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1011620054 6:89234525-89234547 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1011870036 6:91881930-91881952 AAGCACCACCCCCTGCTTCACGG - Intergenic
1012131340 6:95497266-95497288 GGGCACTGCCCCTTGCTCCATGG + Intergenic
1012145068 6:95670366-95670388 TAGCGCCACCCCCTGCTCCACGG + Intergenic
1012189293 6:96260982-96261004 AAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1012578183 6:100829268-100829290 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1012598904 6:101070584-101070606 GAGCACTGCCCCCTGCTCCGTGG + Intergenic
1012733510 6:102910759-102910781 GAGCACCGCTCCCTGCTCCATGG - Intergenic
1012760453 6:103294440-103294462 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1013025669 6:106269443-106269465 GAGTGCCGCCCTCTGCTCCACGG - Intronic
1013081433 6:106816798-106816820 GAGCACCACCCCCTGCTCCACGG - Intergenic
1013410734 6:109881180-109881202 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1013694762 6:112689403-112689425 GAGCGCTGCCCCCTGCTCCATGG - Intergenic
1013955296 6:115834636-115834658 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1013963404 6:115928118-115928140 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1014055937 6:117015077-117015099 GTGCGCCGCTCCCTGCTCCACGG + Intergenic
1014088329 6:117373327-117373349 GGGTGCCGCCCCCTGCTCCGTGG - Intronic
1014280856 6:119441328-119441350 GAGCGCCGCCCCCTGCTTCACGG + Intergenic
1014507809 6:122280904-122280926 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1014586353 6:123202281-123202303 GGGCGCCGCACCCTGCTCCGCGG + Intergenic
1014718610 6:124892297-124892319 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
1014921023 6:127214626-127214648 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1015572201 6:134633580-134633602 GAGCGCCGCCCCCTGCTTCATGG - Intergenic
1015600397 6:134905054-134905076 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1016067317 6:139697951-139697973 CAGCACCGCCCCCTGCTCCAGGG - Intergenic
1016069840 6:139726384-139726406 GAGCACCACCCGCTGCTCCAAGG - Intergenic
1016092778 6:139999620-139999642 GAGTGCCACCCCCTGCTCCAGGG - Intergenic
1016104681 6:140148157-140148179 GAGCGCCGCGCCCTGCTCCGCGG - Intergenic
1016482268 6:144495186-144495208 GAGTGCCACCCCCTGCTCCACGG - Intronic
1016858871 6:148698082-148698104 CAGCCCCGCCCCCTGCTCCAGGG - Intergenic
1016859015 6:148698659-148698681 GATCGCCGCCCTCTGCTCCACGG - Intergenic
1017299031 6:152834668-152834690 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1017325140 6:153133946-153133968 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1017383463 6:153856966-153856988 GGGCGCTGCCCCCTGCTCCACGG - Intergenic
1017537423 6:155363395-155363417 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1017581165 6:155866791-155866813 GAGTGCCACCCCCTGCTCCAGGG - Intergenic
1017809507 6:157974788-157974810 AACCACCTCCCCCTGCTCCCCGG + Intergenic
1017839445 6:158209787-158209809 GAGCGCCGCCTCCTGCTCCAGGG - Intergenic
1017891621 6:158644318-158644340 CATCACCGCCCCTTGCTCTGCGG - Intronic
1018064185 6:160114538-160114560 GAGCACCACCCCCTGCTCCACGG - Intergenic
1018551294 6:165001666-165001688 GAGCGCCGCCCCCTGATCCACGG - Intergenic
1018632400 6:165832581-165832603 GAGCTCCGCTGCCTTCTCCGTGG + Intronic
1018696146 6:166393388-166393410 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1019000213 6:168743820-168743842 GAGCACCACCCCCTGCTCCACGG - Intergenic
1020163962 7:5793817-5793839 GAGTGCCGTCCCCTGCTCCTCGG + Intergenic
1020552234 7:9621519-9621541 GAACGCCGCCCCCTGCTCCAAGG - Intergenic
1020784385 7:12556198-12556220 CAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1021324175 7:19245808-19245830 GAGCACCACCCCCTGCTCCATGG + Intergenic
1021359361 7:19692287-19692309 GGGCAACACCCCCTGCTCCGCGG - Intergenic
1021513754 7:21461234-21461256 AAGCACCGCCCCCTGCTCCATGG - Intronic
1021520666 7:21536625-21536647 AAGTGCCGCCCCCTGCTCCACGG - Intergenic
1021567846 7:22032403-22032425 GAGCGCTGCCCCCTGCTCCAAGG - Intergenic
1022174100 7:27857092-27857114 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1023396162 7:39753986-39754008 GAGCACTGCCCCCTGCTCCATGG - Intergenic
1023990776 7:45127052-45127074 CAGCACCCGCCCCTGCTCCGTGG - Intergenic
1024269126 7:47628800-47628822 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1024335587 7:48202950-48202972 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1024465952 7:49711577-49711599 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
1024691333 7:51806158-51806180 GACCGCCGCCCCCTGCTCCACGG + Intergenic
1024700586 7:51900921-51900943 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1024735765 7:52302930-52302952 GACCACTGCCCCCTGCTCCATGG - Intergenic
1024748156 7:52431278-52431300 GGGCGCCACCCCCTGCTCCACGG - Intergenic
1024794389 7:53004256-53004278 GAGCGCTGCCCCCTGTTCCATGG + Intergenic
1024825379 7:53385197-53385219 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1024834097 7:53495345-53495367 GAGCACCACCTCCTGCTCCACGG + Intergenic
1026187043 7:68090450-68090472 GAGCACCACCCCCTGCTCCACGG - Intergenic
1026202998 7:68231356-68231378 GAGTGCCGCCCCCTGCTCCAGGG + Intergenic
1026335941 7:69394150-69394172 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1026512391 7:71037918-71037940 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1026596511 7:71738116-71738138 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1027237975 7:76309516-76309538 AAGCACCGCCCCCTGCTCCACGG - Intergenic
1027563993 7:79768001-79768023 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1027579665 7:79977640-79977662 GAATGCCGCCCCCTGCTCCATGG - Intergenic
1027665942 7:81043032-81043054 GAGCACCACCCCCTGCTCCACGG + Intergenic
1027674521 7:81142062-81142084 AAGCGCCGCCCCCTGCTCCACGG + Intergenic
1027698233 7:81437126-81437148 GAGTGCCGCCCCATGCTCCAGGG - Intergenic
1027778997 7:82499894-82499916 GAGCACCGCCCCCTGCTCCAAGG + Intergenic
1027868147 7:83673635-83673657 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1027956085 7:84880851-84880873 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1028058680 7:86282188-86282210 GGGAACCGCCCCCTGCTCCAGGG - Intergenic
1028070148 7:86440891-86440913 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1028142547 7:87289048-87289070 GAGTGCTGCCCCCTGCTCCATGG + Intergenic
1028392723 7:90334737-90334759 CAGCGCCGCCCCCTGCTCCACGG + Intergenic
1028511170 7:91627430-91627452 GACCGCCACCCCCTGCTCCACGG - Intergenic
1028778371 7:94705817-94705839 GAGCACCACCCCCTGCTCCACGG + Intergenic
1028989557 7:97034670-97034692 GAGCGCAGCCCCCTGCTCCACGG + Intergenic
1029076188 7:97936206-97936228 GAACACCGCTCCCTGCTCCACGG + Intergenic
1029112150 7:98217924-98217946 GAGCACCCCCACCTGGTCCAGGG + Exonic
1029407148 7:100382056-100382078 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1029567557 7:101348899-101348921 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1029809587 7:103034280-103034302 AAGCGCCGCCCCCCGCTCCACGG - Intronic
1029832327 7:103274961-103274983 GAGCACCACCCCCTGCTCCACGG - Intergenic
1029988216 7:104940477-104940499 GAGTGCCGCCACCTGCTCCACGG + Intergenic
1030102088 7:105955846-105955868 CAGCGCCACCCCCTGCTCCACGG - Intronic
1030215682 7:107042398-107042420 GACCGCCGCCCCCTGCTTCACGG - Intergenic
1030366975 7:108657297-108657319 GAGCTCCGCCCCCTGCTCCATGG - Intergenic
1030733532 7:113017667-113017689 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1030780463 7:113593642-113593664 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1030819265 7:114076887-114076909 GAGCGCCGCTTCCTGCTCCACGG - Intergenic
1030980645 7:116182019-116182041 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1031056485 7:116998033-116998055 AAGCACCGCGCCCCGCTCCACGG - Intronic
1031110009 7:117596433-117596455 GAGCACCGCCCCCTGCTCCACGG + Intronic
1031292212 7:119951547-119951569 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1031378838 7:121060259-121060281 GAGCGCCGCCCCTTGCTCCACGG + Intronic
1031409255 7:121422051-121422073 AAGCACCGCCCCCTGCTCCACGG + Intergenic
1031605489 7:123763252-123763274 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1031902919 7:127429495-127429517 GAGTGCTGCCCCCTGCTCTGTGG + Intronic
1032248119 7:130230346-130230368 GAGCACCACCCCCTGCTCCACGG + Intergenic
1032339698 7:131059085-131059107 GAGCGCTGCCCCCTGCTCCGCGG + Intergenic
1032437169 7:131909649-131909671 GAGCGCTGCCCCGTGCTCCGCGG + Intergenic
1033065123 7:138146445-138146467 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1033312383 7:140271381-140271403 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1033394045 7:140956991-140957013 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1033664054 7:143424434-143424456 GAATGCCGCCCCCTGCTCCAGGG - Intergenic
1033758570 7:144418006-144418028 AAGCACCACCCCCTACTCCACGG - Intergenic
1033839862 7:145360632-145360654 GATCACCACCTCCTGCTCCACGG - Intergenic
1033866602 7:145697449-145697471 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
1034097964 7:148426732-148426754 GAGCACTGCCCCCTGCTGTACGG + Intergenic
1034155066 7:148949405-148949427 GAGCACCACCCCCTGCTCCACGG + Intergenic
1034167709 7:149038735-149038757 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1034632096 7:152538924-152538946 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1034655990 7:152730312-152730334 GAGCACCACCCCCTGCTCCATGG - Intergenic
1034900894 7:154907225-154907247 CGGCACCACCCCCTGCTCTGCGG + Intergenic
1034967047 7:155398181-155398203 GAACACTGCCCCCTGCTCCATGG - Intergenic
1035151138 7:156874042-156874064 GAGCACCACCCCCTGCTCCACGG - Intronic
1035325461 7:158062893-158062915 AAGCGCCGCCCCCTGCTCCGCGG + Intronic
1035363424 7:158329096-158329118 GCGCACAGCCCACTGCACCGAGG + Intronic
1035463850 7:159063174-159063196 AAGTGCCGCCCCCTGCTCCGCGG - Intronic
1035640820 8:1183716-1183738 TATCACCGCCTCCTGGTCCGAGG + Intergenic
1035683523 8:1507194-1507216 GGACGCTGCCCCCTGCTCCGCGG - Intronic
1035743990 8:1948253-1948275 GCTCTCAGCCCCCTGCTCCGGGG + Intronic
1035752893 8:2008395-2008417 GAGCACAGAGCCCTGCTCCTGGG + Intergenic
1035999288 8:4583151-4583173 GAGCACCATCCTCTGCTCCACGG + Intronic
1036260509 8:7235974-7235996 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1036306104 8:7603548-7603570 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1036312546 8:7694530-7694552 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1036356950 8:8051533-8051555 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1036378307 8:8219196-8219218 GGGCACCACCCCCTGCTCCAGGG + Intergenic
1036440980 8:8781428-8781450 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1036554616 8:9847836-9847858 GAGCGCCGCTCCCTGCTCCGTGG - Intergenic
1036801411 8:11795087-11795109 GAGCGCCACCCCCTGTTCCACGG + Intergenic
1036851267 8:12203421-12203443 GACCACAGCCCCCTGCTCCAGGG - Intergenic
1036872631 8:12445695-12445717 GACCACAGCCCCCTGCTCCAGGG - Intergenic
1036901621 8:12673729-12673751 AAGCACCTTCCCCTGCTCCACGG + Intergenic
1036915025 8:12796587-12796609 GGGCGCCGCCCCCTGCTCCACGG + Intergenic
1037173727 8:15923618-15923640 GGGCGCTGCCCCCTGCTCTGTGG + Intergenic
1037239463 8:16760577-16760599 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1037241600 8:16784230-16784252 GAGCACCACCCCCTGCTCCACGG + Intergenic
1037263796 8:17036854-17036876 GAGCACCACCCCCTGCGCCACGG - Intronic
1037425559 8:18751080-18751102 GAGCACCGCCCCCTGCTGCACGG - Intronic
1037558983 8:20055049-20055071 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1037811026 8:22086879-22086901 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1037957505 8:23070830-23070852 GAGCACCTCCCCCTGCTCCAGGG - Intergenic
1037971293 8:23173836-23173858 GAGCACCTCCCCCTGCTCCATGG - Intergenic
1037983573 8:23272440-23272462 TAGCACCACCCCCCGCTCCACGG + Intronic
1038174114 8:25164819-25164841 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1038638324 8:29304577-29304599 GAGCGCCGTCCCCTGCTCCATGG + Intergenic
1038639451 8:29311789-29311811 GAGTGCCGCCCCCTGCTCCATGG + Intergenic
1038870750 8:31490191-31490213 GAGCGCTGCCCACTGCTCCATGG + Intergenic
1039061353 8:33574227-33574249 GAGCGCCACCCTCTGCTCCACGG + Intergenic
1039284906 8:36029150-36029172 GAGCACCACACCCTGCTCCATGG + Intergenic
1039587654 8:38720120-38720142 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1039608489 8:38901422-38901444 GAGCCCCGGCCCCTGCACGGGGG + Exonic
1039637353 8:39180451-39180473 GAGCGCTGCCCCCTGCTCCACGG + Intronic
1040323995 8:46332013-46332035 GAGCACCGCCCCCTGTTCCATGG + Intergenic
1040351318 8:46571849-46571871 GAGCCCCGCCACCTGCTCCACGG + Intergenic
1040516973 8:48143455-48143477 GAGCACAGCACCGAGCTCCGAGG - Intergenic
1040791052 8:51230925-51230947 GAGCGCCGCTCCCTGCTCCATGG + Intergenic
1040806789 8:51404860-51404882 GATCACCGTCCCCTGCTCTGGGG - Intronic
1040952662 8:52952893-52952915 GAGCACCACCCCCTGCTCCATGG - Intergenic
1040952928 8:52954133-52954155 GAGCACCGCCACCTGCTCCACGG + Intergenic
1040954045 8:52961689-52961711 GATCACTGCACCCTGCTCCATGG + Intergenic
1040964539 8:53071180-53071202 GGGTGCCGCCCCCTGCTCCCCGG - Intergenic
1040965520 8:53077669-53077691 GGGCACTGCTCCCTGCTCTGTGG - Intergenic
1041034613 8:53775937-53775959 GAGCACCGCCCCCTGCTCCACGG - Intronic
1041068584 8:54104519-54104541 CAGCACCTCCCTTTGCTCCGCGG + Intergenic
1041689779 8:60678294-60678316 GAGCCCCGCTTCCTGCCCCGGGG + Intergenic
1041914568 8:63126397-63126419 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1041918976 8:63162313-63162335 GAGCACCACCCCCTACTCCACGG + Intergenic
1042169443 8:65977833-65977855 GAGTGCAGCCCCCTGCTCCACGG - Intergenic
1042512523 8:69626521-69626543 GAGCACCACCCCCTGCTCTATGG - Intronic
1043102188 8:76060489-76060511 GAGCGCTGCCCTCTGCTCCACGG - Intergenic
1043110148 8:76169894-76169916 GAGCGCAGCCCCCTGCTCCACGG + Intergenic
1043129886 8:76447650-76447672 GAGCACTGCCCCCTGCTCCACGG - Intergenic
1043346506 8:79303818-79303840 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1043352440 8:79377240-79377262 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
1043640207 8:82441701-82441723 CAACGCCGCCCCCTGCTCCGTGG + Intergenic
1043709933 8:83403270-83403292 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1043731903 8:83694034-83694056 AAGCACCACCCCCTGCTCCACGG - Intergenic
1043857205 8:85276349-85276371 GATCGCTGCCCCCTGCTCCACGG + Intronic
1044075870 8:87821158-87821180 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1044404929 8:91816645-91816667 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
1044633427 8:94300370-94300392 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1044788732 8:95823962-95823984 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1044862110 8:96533883-96533905 GAGCGCCGCCCCCTGCTCCATGG - Intronic
1045131897 8:99163436-99163458 GAGCACCACCCCCTATTCCACGG - Intronic
1045232281 8:100316811-100316833 GAGCACCACCCCCTGCTCCACGG - Intronic
1045306000 8:100957221-100957243 GAGCACCACTCCCTGCTCCACGG - Intergenic
1045467714 8:102485550-102485572 GAGCGCTGCCCCCTGCTCCACGG - Intergenic
1045933780 8:107655922-107655944 GGGCACCACCCCCTGCTCCGTGG + Intergenic
1046208840 8:111040874-111040896 GAGCGCCGCCCCCTGCTCCTCGG - Intergenic
1046251928 8:111643150-111643172 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1046265346 8:111823329-111823351 GAGCACCACCCCCTGCTCCACGG - Intergenic
1046285007 8:112083056-112083078 GAGCGCCACCCTCTGCTCCACGG - Intergenic
1046288956 8:112133015-112133037 GAGCGCCACCTCCTGCTCCACGG + Intergenic
1046445385 8:114311674-114311696 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1046450759 8:114386480-114386502 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1046497818 8:115037015-115037037 AGGCACCGCCCCCTGCTCCATGG + Intergenic
1046621254 8:116531368-116531390 GAGTGCTGCCCCCTGCTCCATGG + Intergenic
1046661153 8:116949786-116949808 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1047124806 8:121948403-121948425 GAGTGCCACCCCCTGCTCCAGGG + Intergenic
1047631659 8:126714674-126714696 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1048112899 8:131487352-131487374 GAGCACCGCCCCCTGCTCCAAGG + Intergenic
1048186843 8:132249695-132249717 GAGCACCGCCCCCTGCTCTGCGG - Intronic
1048655372 8:136530489-136530511 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1048676916 8:136793839-136793861 AAGCCCCGCCCCCTGCTCCAGGG - Intergenic
1048757453 8:137755157-137755179 GAGCACCACCCCCTGCTCCACGG - Intergenic
1048789222 8:138084459-138084481 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1049087589 8:140490552-140490574 GACTGCCGCCCCCTGCTCCACGG - Intergenic
1049090640 8:140511393-140511415 GAGCCGCGCCCGCTGCCCCGTGG - Exonic
1049671394 8:143871673-143871695 CAGCATCGCCCTCTGCTCTGAGG + Exonic
1049944465 9:580808-580830 GAGCACCGCCCCCTGCTCCGCGG - Intronic
1050249990 9:3734090-3734112 GAGCGCCGCCCCCTACTCCACGG + Intergenic
1050892049 9:10836280-10836302 CAGCACTGCCCCCTGCTCCATGG + Intergenic
1050920661 9:11197189-11197211 GAGCACCACCCCCTGCTGCATGG + Intergenic
1051305041 9:15700081-15700103 GAGCACTGCCCCCTGCTCCACGG - Intronic
1051419676 9:16877126-16877148 GAGCACCACTCCCAGCTCCATGG - Intergenic
1051439903 9:17072926-17072948 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1051459297 9:17294712-17294734 GAGCTCTGCCCCCTGCTCCACGG - Intronic
1051463845 9:17354258-17354280 GAGCACCACCCCCTGCTCCAGGG + Intronic
1051892742 9:21959574-21959596 GAGCACCACCCCCTGCTCCACGG + Intronic
1052313467 9:27092934-27092956 GAGCGCAGCCCCCTGCTCCACGG + Intergenic
1052576618 9:30299588-30299610 AAGTGCCGCCCCCTGCTCCATGG + Intergenic
1052979597 9:34438268-34438290 GAGCGCCACCCCCTGCTCCACGG + Intronic
1052985300 9:34482801-34482823 GAGCACCATCCTCTGCTCCACGG - Intronic
1053027237 9:34740273-34740295 TAGCGCCGCCCCCTGCTCCATGG - Intergenic
1053393487 9:37752247-37752269 GAGCACTGACCCCTGCTCCACGG + Intronic
1053436132 9:38075647-38075669 GAGTGCCGCCCCCTGCTCCACGG + Intergenic
1053547867 9:39042394-39042416 GAGCACCACCCCCTGCTCCACGG - Intergenic
1053678342 9:40461342-40461364 CGGCACTGCCCCCTGCTTCGTGG + Intergenic
1053811991 9:41862435-41862457 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1053928324 9:43089686-43089708 GGGCACTGCCCCCTGCTTCGTGG + Intergenic
1054291419 9:63296879-63296901 CGGCACTGCCCCCTGCTTCGTGG + Intergenic
1054506278 9:65914953-65914975 CGGCACTGCCCCCTGCTTCGTGG - Intergenic
1054618604 9:67325004-67325026 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1054722503 9:68617347-68617369 GAGCGCGGCCCCCTGCTCCACGG + Intergenic
1055049407 9:71963861-71963883 CAGCGCCACCCCCTGCTCCACGG + Intronic
1055102526 9:72480276-72480298 GAGTGCCGCCCCCTGCTCCACGG - Intergenic
1055358438 9:75462300-75462322 GAGCCCCTGCCCCTGCTCCCTGG + Intergenic
1055461416 9:76523766-76523788 AAGCACCGCCCCCTGCTCCATGG - Intergenic
1055654984 9:78442397-78442419 GAGCGCCACCGCCTGCTCTGTGG + Intergenic
1055985480 9:82054418-82054440 GAGCACCGCCCCCTGCTCTGCGG - Intergenic
1056080914 9:83093334-83093356 AAGTGCCACCCCCTGCTCCGCGG - Intergenic
1056216327 9:84408804-84408826 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1056743798 9:89282748-89282770 AAGTGCCGCCCCCTGCTCCACGG + Intergenic
1056771347 9:89480455-89480477 GAGAGCCACCCCCTGCTCCACGG - Intronic
1056972328 9:91216746-91216768 GTGCACCACCCCCTCCTCCCAGG + Intronic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057511180 9:95680654-95680676 GAGTGCGGCCCCCTGCTCCACGG + Intergenic
1057543814 9:96001756-96001778 GAGCGCCACCCCCTGCTCCACGG - Intronic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1057726953 9:97574497-97574519 AAGCGCCGCCCCCTGCTCCACGG + Intronic
1057907142 9:98992147-98992169 GGGGACCGCCCCCTGCTCTGCGG - Intronic
1058174823 9:101724152-101724174 GAACGCCACCCCCTGCTCCATGG - Intronic
1058235650 9:102487020-102487042 GAGCGCAGCCCCCTGCTCCATGG - Intergenic
1058286610 9:103187215-103187237 GACCTCCGCCCCCTGCTCCAGGG + Intergenic
1058365227 9:104200917-104200939 GAGCACTGCCCCCTGCTCCATGG + Intergenic
1058379526 9:104362939-104362961 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1058727574 9:107818126-107818148 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1058786543 9:108393837-108393859 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1058799413 9:108530466-108530488 GAGCGCTGCCCCCTACTCCACGG + Intergenic
1059315089 9:113417551-113417573 GAGGACCGCCCCCTGGTGTGTGG + Intronic
1059791111 9:117642802-117642824 GAGCGCCACCCCCTGCTCCAAGG - Intergenic
1059810668 9:117852348-117852370 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1059891410 9:118809296-118809318 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1059991517 9:119870319-119870341 GAGCACCACCCCCTGTTCCATGG - Intergenic
1060091388 9:120746668-120746690 GAGCGCTGCCCCCTGCTCCACGG + Intergenic
1060305334 9:122406236-122406258 GAGCGCCACCCCCTGCTCTACGG - Intergenic
1060477903 9:123999552-123999574 GTCCCCCGCCCCCCGCTCCGTGG - Intergenic
1060999934 9:127897311-127897333 CAGCTCCGTCCCCTGCTCCAGGG + Intronic
1061284091 9:129612493-129612515 GAGCCCAGTCCCCTGCCCCGAGG - Intronic
1062159112 9:135069929-135069951 CAGCACCAAACCCTGCTCCGTGG - Intergenic
1062341511 9:136095590-136095612 GAGCTCCGTCCTCTGCGCCGCGG - Intergenic
1203524019 Un_GL000213v1:68983-69005 GACCCCTGCCCCCTGCTCCCCGG + Intergenic
1203460389 Un_GL000220v1:31062-31084 GAGCTCCACCCCCTGTTCCATGG - Intergenic
1186152549 X:6690545-6690567 GAGCGCCACGCCCTGCTCCACGG - Intergenic
1186282049 X:8003354-8003376 GAGCACTGCCCCCTGCTCCACGG - Intergenic
1186323208 X:8452528-8452550 GAGCACCACCCCCTGCTCCACGG - Intergenic
1186697671 X:12054379-12054401 CAGCACCTCCCTCTGCTCCTTGG + Intergenic
1187139098 X:16575775-16575797 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1187304654 X:18084126-18084148 GAGCACCACCCCCTGCTCCACGG + Intergenic
1187557529 X:20366887-20366909 GAGCACCACCCCCTGCTCCACGG - Intergenic
1188112045 X:26205082-26205104 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1188166917 X:26873738-26873760 GAGGGCCGCCCCCTGCTCCACGG - Intergenic
1188189573 X:27157326-27157348 GAATGCCGCCCCCTGCTCCACGG + Intergenic
1188242719 X:27809614-27809636 GAGCGCCGCCCCCCGCTCTGCGG + Intronic
1188881879 X:35499602-35499624 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1189896802 X:45664855-45664877 GAGCTCCGCCCCCTGCTCCATGG - Intergenic
1190045824 X:47111041-47111063 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1191618593 X:63192609-63192631 GAGCACAACCTCCTGCTCCATGG - Intergenic
1192186796 X:68952437-68952459 AAGCGCTGCCCCCTGCTCCCCGG + Intergenic
1192869617 X:75173635-75173657 GAGCACTTCCCCCTGCTCCATGG - Intergenic
1192870525 X:75179555-75179577 GAGCACCACCCCCTGCTCCATGG - Intergenic
1193951725 X:87808733-87808755 AAGCACGGCCCCCTACTCCATGG - Intergenic
1194071557 X:89331067-89331089 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1194121166 X:89965684-89965706 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1194166390 X:90521658-90521680 GAGCACCACCCCCTGCTCCACGG + Intergenic
1194650778 X:96512289-96512311 GAGCACCACCCCCTGCTCCACGG - Intergenic
1195256352 X:103094400-103094422 GAGCGCCGCCCCCTGCTGCACGG + Intergenic
1195257994 X:103107387-103107409 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1195460226 X:105115787-105115809 GAGCGCCGCTCTCTGCTCCAGGG - Intronic
1195909563 X:109875932-109875954 GAGCGCCACCCCCTGCTTCAAGG - Intergenic
1196197885 X:112854936-112854958 GAGCGCCGACCCCTGCTCCATGG - Intergenic
1196319487 X:114270598-114270620 GAGCGCCGCTTCCTGCTCCACGG - Intergenic
1196582736 X:117395003-117395025 AAGCACTGCCCCCTGCTCCACGG + Intergenic
1196662486 X:118282779-118282801 GAGCACCACCCCCTGCTCCACGG - Intergenic
1196714659 X:118799279-118799301 GAGCACTACCCCCTGCTCCACGG + Intergenic
1196762303 X:119210917-119210939 GAGCACCACCCCCTGCTCCATGG - Intergenic
1196771544 X:119300004-119300026 GAGCACCGCCCCCTGCTGCAGGG + Intergenic
1196775246 X:119332197-119332219 AAGCACCACCCCCTGCTCCATGG + Intergenic
1196781423 X:119387622-119387644 GAGCACCACCCCCTGCTCCATGG - Intergenic
1196793939 X:119487901-119487923 GAGCACCACACCCTGCTCCACGG - Intergenic
1196827225 X:119750859-119750881 GAGCACCACCCCCTGCTCCACGG - Intergenic
1196845101 X:119890914-119890936 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1197331132 X:125155506-125155528 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1197340096 X:125255970-125255992 GAGCACCGCCCTCTGCTCCACGG + Intergenic
1197344788 X:125319100-125319122 GAGCACCACCCCCTGCTCCACGG - Intergenic
1197376754 X:125690617-125690639 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1197978801 X:132194408-132194430 GAGCACCGCCACCTGCTCTGCGG + Intergenic
1198468147 X:136921686-136921708 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1198694495 X:139321126-139321148 GCGCTCCGCCCCCTGCTCGACGG + Intergenic
1198872268 X:141188576-141188598 GAGCGCCGCCCCCTGATCTATGG - Intergenic
1198972546 X:142298283-142298305 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1199009896 X:142745761-142745783 GAGCACCACCCCCTGCTCCACGG - Intergenic
1199028756 X:142972174-142972196 GACCACCACCCGCTGCTCCACGG - Intergenic
1199094792 X:143726272-143726294 GGGCACCACCCCCTGCTCCGCGG - Intergenic
1199134131 X:144231289-144231311 GAGTACCGCCCCCTGTTCCACGG - Intergenic
1199175584 X:144783941-144783963 GAATGCCGCCCCCTGCTCCAGGG + Intergenic
1199285055 X:146046223-146046245 GAGCGCTGCCCCCTGCTCCATGG - Intergenic
1199628148 X:149758848-149758870 GAGCGCCACTCCCTGCTCCACGG + Intergenic
1199831238 X:151551224-151551246 GAGCACCACCCCCTGCTCCACGG - Intergenic
1199831752 X:151555229-151555251 GAGCACTGCTCCCTGCTCCACGG - Intergenic
1200034643 X:153319550-153319572 GTGGACCGCCCCCTTCTCCACGG + Intergenic
1200115619 X:153768565-153768587 GAGCACTGCCCCCTGCAGCCCGG + Intronic
1200423519 Y:2998413-2998435 GAGCACCACCCCCTGCTCCACGG - Intergenic
1200470851 Y:3584128-3584150 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1200474020 Y:3623135-3623157 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1200512658 Y:4099439-4099461 GAGCACCACCCCCTGCTCCACGG + Intergenic
1200725795 Y:6666796-6666818 GAGCGCCACCCCCTGCTCCTCGG - Intergenic
1200824250 Y:7622254-7622276 GAGCACCACCCCCTGCTCCACGG - Intergenic
1200873585 Y:8128554-8128576 GAGCGCCGCCCACTGCTCCAGGG - Intergenic
1201429212 Y:13888105-13888127 GAGCACCGCTCCCTGCTCCATGG + Intergenic
1201468375 Y:14309566-14309588 GAGCACTACTCCCTGCTCCACGG + Intergenic
1201469141 Y:14314773-14314795 AAACACCGCTCCCTGCTCCATGG + Intergenic
1201479980 Y:14428413-14428435 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1201555311 Y:15260439-15260461 AAACACCGCTCCCTGCTCCATGG + Intergenic
1201715848 Y:17043435-17043457 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1201901069 Y:19046609-19046631 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
1201982578 Y:19923754-19923776 GAGCACCACCCCCTGCTCCACGG - Intergenic
1202109887 Y:21407524-21407546 GAGCGCCGCCCCCTACTCCACGG + Intergenic
1202137049 Y:21676701-21676723 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1202235804 Y:22708833-22708855 GAGCACCACCCCCTGCTCCACGG + Intergenic
1202271449 Y:23078377-23078399 GAGCGCCACCCCCTACTCCATGG - Intergenic
1202272568 Y:23085685-23085707 GAGCACCGCCCCCTGTTCAAGGG - Intergenic
1202293458 Y:23334997-23335019 GAGCACCGCCCCCTGTTCAAGGG + Intergenic
1202294577 Y:23342305-23342327 GAGCGCCACCCCCTACTCCATGG + Intergenic
1202307359 Y:23487335-23487357 GAGCACCACCCCCTGCTCCACGG - Intergenic
1202424444 Y:24712121-24712143 GAGCGCCACCCCCTACTCCATGG - Intergenic
1202425565 Y:24719429-24719451 GAGCACCGCCCCCTGTTCAAGGG - Intergenic
1202445224 Y:24950656-24950678 GAGCACCGCCCCCTGTTCAAGGG + Intergenic
1202446345 Y:24957964-24957986 GAGCGCCACCCCCTACTCCATGG + Intergenic
1202563446 Y:26183251-26183273 GAGCACCACCCCCTGCTCCACGG + Intergenic