ID: 1049944584

View in Genome Browser
Species Human (GRCh38)
Location 9:581248-581270
Sequence GCCCCCTCTGGCCGTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 980
Summary {0: 1, 1: 38, 2: 190, 3: 300, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049944584_1049944587 -6 Left 1049944584 9:581248-581270 CCTCAAGCACGGCCAGAGGGGGC 0: 1
1: 38
2: 190
3: 300
4: 451
Right 1049944587 9:581265-581287 GGGGGCGCCGAGAGCAGGCAAGG No data
1049944584_1049944588 -5 Left 1049944584 9:581248-581270 CCTCAAGCACGGCCAGAGGGGGC 0: 1
1: 38
2: 190
3: 300
4: 451
Right 1049944588 9:581266-581288 GGGGCGCCGAGAGCAGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049944584 Original CRISPR GCCCCCTCTGGCCGTGCTTG AGG (reversed) Intronic
900106087 1:981731-981753 GCCACCTCGGGCCGTCCTCGAGG + Intronic
900191957 1:1355789-1355811 GCCCCCTAGGGCCCTGGTTGGGG + Intronic
900345541 1:2208671-2208693 ACCCGCTCTGGCCGAGCATGGGG - Intronic
902032070 1:13430448-13430470 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
902032693 1:13434323-13434345 GCCCACTCTGGCCGCACTTGAGG - Intergenic
902148235 1:14421004-14421026 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
903624536 1:24721411-24721433 GCCCACTCTGGCCATGCTTGAGG + Intergenic
905272004 1:36793426-36793448 GCCCCCTCATGGAGTGCTTGTGG - Intergenic
905742818 1:40387740-40387762 ACCCACTCTGGCCGCACTTGAGG + Intronic
906056046 1:42917462-42917484 ATCCGCTCTGGCCATGCTTGAGG - Intergenic
906083280 1:43107984-43108006 GCCCATTCTGGCCATGCTTGAGG - Intergenic
906204638 1:43980183-43980205 GCCACTTCTGGCAGTGCTTCAGG - Intronic
906574562 1:46876036-46876058 GCCCCTTCTGGTCGTGCTATGGG - Intergenic
906876081 1:49541219-49541241 GCCCACTCTGGCCATGCTTGAGG + Intronic
907102302 1:51847841-51847863 GCCCACTCTGGCTGTGCTTGAGG - Intronic
907371211 1:54004697-54004719 GCCCATTCTAGCCGTGCTTGAGG - Intergenic
907403308 1:54238849-54238871 GCCACCTCCTGCCGTGCTGGTGG - Intronic
907759563 1:57343881-57343903 GCCCACTCTGGCCACACTTGAGG - Intronic
908299859 1:62753317-62753339 GTCCACTCTCGCCATGCTTGAGG + Intergenic
909318620 1:74253822-74253844 GCCCACTCTGGCTGCACTTGAGG - Intronic
909608795 1:77532198-77532220 GCCCACTCTGGCCGCGCTTGAGG - Intronic
910316004 1:85884603-85884625 GCCCCCTCTGGCCTTTGATGTGG - Intronic
910334270 1:86110445-86110467 GTCCACTCTGGCCGCGCTTGAGG + Intronic
910478886 1:87636701-87636723 ACCCAATCTGGCCATGCTTGAGG - Intergenic
910550216 1:88466944-88466966 GTCCGCTCTGGCCATGCTCGGGG + Intergenic
911001386 1:93170154-93170176 GCCCACTCTGGCCACGCCTGAGG + Intronic
911950807 1:104172211-104172233 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
912069800 1:105795794-105795816 GTCCGCTCTGGCCGCGCTGGAGG + Intergenic
912309172 1:108602348-108602370 GCTCCCTCTGGAAGTGCTGGGGG + Intronic
912538831 1:110396812-110396834 CCCCATTCTGGCAGTGCTTGAGG - Intergenic
912824628 1:112894584-112894606 GCCCACTCTGGCCACGCTTGAGG + Intergenic
913178714 1:116298462-116298484 GTCCACTCTGGCAGCGCTTGAGG - Intergenic
913486049 1:119333639-119333661 GCCTACTCTGGCCGCCCTTGAGG + Intergenic
913987035 1:143574980-143575002 GCCCATTCTGGCCGCACTTGAGG + Intergenic
914224217 1:145707153-145707175 GGCCCCTTTGGCGGTGGTTGGGG - Intronic
915242382 1:154532548-154532570 GCCCATTCTGGCCGCGCTTGAGG - Intronic
916606113 1:166343506-166343528 GCCCACTCTGGCCACGCTTGAGG - Intergenic
918154510 1:181832301-181832323 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
918283023 1:183023770-183023792 GCCCGTGCTGGCCGTGCTGGCGG + Exonic
918789898 1:188812973-188812995 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
918943043 1:191026469-191026491 GTCTGCTCTGGCCATGCTTGAGG - Intergenic
919250778 1:195054207-195054229 GCCCACTCTGGCCATGCTTGAGG + Intergenic
919419835 1:197355867-197355889 ACCCACTCTGGCCACGCTTGAGG - Intronic
920150156 1:203900122-203900144 GCCCATTCTGGCCGTGCTTGAGG + Intergenic
920604933 1:207371870-207371892 GTCCGCTCTGGCCATGCTTGAGG - Intergenic
920878526 1:209859125-209859147 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
920882095 1:209889414-209889436 GCCCACTCTGGCCACGCTTGAGG - Intergenic
921094494 1:211874767-211874789 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
921096217 1:211889434-211889456 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
922166209 1:223117410-223117432 GCCCACTCTGGCCGTGCTTGAGG - Intronic
922417005 1:225431251-225431273 GCCCACTCTGGCCGCTCTTGAGG + Intergenic
922546785 1:226464082-226464104 GTCCACTATGGCCATGCTTGAGG + Intergenic
923353113 1:233129009-233129031 GTCTGCTCTGGCCATGCTTGGGG + Intronic
923810573 1:237310086-237310108 ACCCACTCTGGCCATGCTTTAGG - Intronic
924034854 1:239925243-239925265 GTCCACTCTGGCTGTGCTTGAGG - Intergenic
924305877 1:242689310-242689332 GCCCACTCTGGCCGCACTTGAGG + Intergenic
1063149028 10:3320302-3320324 ACCCATTCTGGCCGCGCTTGAGG - Intergenic
1064449281 10:15426550-15426572 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1064791435 10:18960960-18960982 GCCCTCCCTGGCCCTGCTTCAGG + Intergenic
1065284851 10:24177172-24177194 GTCCACTCTGGTCATGCTTGAGG - Intronic
1065340529 10:24700325-24700347 GCTCTCTCTGCACGTGCTTGCGG - Intronic
1065554837 10:26905432-26905454 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
1065981636 10:30903272-30903294 ATCCATTCTGGCCGTGCTTGAGG - Intronic
1065983918 10:30930514-30930536 GTCCACTCTGGCCACGCTTGAGG - Intronic
1066293556 10:34035280-34035302 GCCCACTCTGGCTGCACTTGAGG + Intergenic
1066568632 10:36748199-36748221 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1066575413 10:36819817-36819839 GCCCACTCTGGCTGCTCTTGAGG + Intergenic
1066590627 10:36989764-36989786 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1066648440 10:37634356-37634378 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1066660837 10:37737261-37737283 GCCCACTCTAGCCATGCTTGAGG + Intergenic
1067071754 10:43137889-43137911 GCCCGCTTAGGCCGTGCTCGCGG + Intergenic
1067363122 10:45600632-45600654 GCCCACTCTGGCGGCGCTTGAGG + Intergenic
1067816851 10:49485182-49485204 GGCCCCTCTGTCCTTCCTTGGGG - Intronic
1068211265 10:53924068-53924090 GCCCACTCTGGCCGCGCTTGAGG + Intronic
1068455470 10:57249725-57249747 GCCCATTCTGGCTGCGCTTGAGG + Intergenic
1069215415 10:65812528-65812550 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1070172664 10:73944512-73944534 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1070828187 10:79403427-79403449 GCCTCCCCCGGCCGTGCATGTGG - Intronic
1070942627 10:80359958-80359980 GCCCACTCTGGCCATGCTTGAGG - Intronic
1071055637 10:81505712-81505734 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1071078656 10:81784104-81784126 ACCCACTCTAGCCGTGCTTGAGG + Intergenic
1071332117 10:84571086-84571108 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1071611075 10:87031439-87031461 GTCCACTCTGGCCATGCTTGAGG - Intergenic
1071797129 10:89019050-89019072 GCCCACTCTGGCTGTGCTTGAGG - Intergenic
1071963844 10:90832650-90832672 GCCCATTCTGGCCATGCTTGAGG - Intronic
1072687752 10:97548920-97548942 GCCACATCTGGCCGGGCTCGGGG - Intronic
1073094518 10:100971589-100971611 GCACCCTCTGGCCCTGCCTGTGG + Intronic
1073262558 10:102201343-102201365 GGCCTCACTGGCCGTGCTTGAGG - Intergenic
1073532444 10:104245056-104245078 ACCCACTCTGGCGGTGCTTGAGG + Intronic
1074314523 10:112349630-112349652 GTCCACTCTGGCGGTGCTTCAGG + Intergenic
1075505076 10:123013976-123013998 GCCCATTCTGGCCACGCTTGAGG - Intronic
1076608860 10:131707902-131707924 GATCCCCCTGGCTGTGCTTGGGG - Intergenic
1076873030 10:133202851-133202873 GCCCCCTCAGGCCCTGTGTGGGG - Intronic
1077359274 11:2133516-2133538 GACCCCTCCGACCGTGCTTCCGG - Exonic
1077441286 11:2570326-2570348 GCCCCCTCTGGCCAAGGCTGGGG + Intronic
1078452853 11:11453198-11453220 GTCTCCTCAGGCCGTACTTGGGG - Intronic
1078682203 11:13487368-13487390 CTCCAGTCTGGCCGTGCTTGAGG - Intergenic
1078891265 11:15560809-15560831 GCCCATTCTGGCCGCGCTTGAGG + Intergenic
1079689052 11:23400081-23400103 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1079708742 11:23653623-23653645 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1079756866 11:24274714-24274736 GCCCACTCTGGCTGTGCTTGAGG - Intergenic
1080138794 11:28890628-28890650 GCCCACTCTGGCCAAGCTTGAGG + Intergenic
1080223463 11:29934099-29934121 GCCACCACTGGCCATGCTTGAGG + Intergenic
1080503153 11:32888643-32888665 GCCCACTCTGGCCACACTTGAGG - Intergenic
1081046470 11:38279075-38279097 GTCCACTCTAGCCGCGCTTGAGG - Intergenic
1081127005 11:39333542-39333564 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1081136226 11:39442537-39442559 GCCCACTCTGCCCATGCTCGAGG - Intergenic
1081315140 11:41622762-41622784 GCCCATTCTGGCCGTGCTTGAGG + Intergenic
1081324527 11:41728558-41728580 GTCCACTCTGGCCGTGCTTGAGG - Intergenic
1081374771 11:42344808-42344830 GCCCACTGTGGCCATGTTTGAGG - Intergenic
1082106667 11:48228795-48228817 TCCCACTCTGGCCACGCTTGAGG + Intergenic
1082270485 11:50164476-50164498 ACCCACTCTGGCCGCACTTGAGG - Intergenic
1082912394 11:58391046-58391068 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1084024820 11:66441208-66441230 TCCCACTCTGGCCCCGCTTGAGG - Intronic
1084035737 11:66509231-66509253 GCCCCATCTGGCCAAGCTTGAGG + Exonic
1084186582 11:67475978-67476000 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
1084419690 11:69054111-69054133 GCTCCCTGTGGCCGGGCCTGGGG + Intronic
1084443552 11:69190151-69190173 TGCCCCTCTGGCCTTGCCTGGGG + Intergenic
1084679697 11:70659717-70659739 GCCCAGTCTGGGGGTGCTTGTGG - Intronic
1085687625 11:78638733-78638755 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1085941057 11:81207481-81207503 GCCCAATCTGGCCGCGCTTGAGG + Intergenic
1086001155 11:81987150-81987172 GTCCACTCTGGCCGCACTTGAGG - Intergenic
1086087490 11:82970559-82970581 GTCCATTCTGGCCGCGCTTGAGG + Intronic
1086397818 11:86433996-86434018 GCCCACCCTGGCCACGCTTGAGG - Intergenic
1086724578 11:90167077-90167099 GCCCACTCTGGCCACGCTTGAGG + Intronic
1087400934 11:97666968-97666990 GTCCACTCTAGCCATGCTTGAGG + Intergenic
1087441248 11:98185693-98185715 GTTCACTCTGGCCATGCTTGAGG - Intergenic
1087682407 11:101231810-101231832 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1087683865 11:101241724-101241746 ACCCACTCTGGCCATGCTTGAGG - Intergenic
1087966629 11:104422904-104422926 ACCCACTCTGGCCTCGCTTGAGG - Intergenic
1088844030 11:113649789-113649811 GTCTGCTCTGGCCATGCTTGAGG - Intergenic
1089174099 11:116536084-116536106 GCCCCCTCTGTCTGTGCATTGGG - Intergenic
1089244805 11:117110925-117110947 GCCCACTCTGGCCACACTTGAGG - Intergenic
1089666793 11:120025784-120025806 GCCCACTCTGGCCGCACTTGAGG + Intergenic
1090502592 11:127275949-127275971 GGCACCTCTGGGCCTGCTTGCGG + Intergenic
1090558209 11:127899042-127899064 GCCCCTTCTGGCTGTGCTTGAGG - Intergenic
1091201147 11:133782235-133782257 GCCCATTCTGGCCGTGCTTGAGG + Intergenic
1091402313 12:188549-188571 GCCCACTCTGGCTGCGCTTGAGG - Intergenic
1091513458 12:1153726-1153748 CCCCTCCCTGGCCGTGCGTGTGG + Intronic
1092133892 12:6132500-6132522 GCCCACTCTGGCCGCACTTGAGG + Intergenic
1092545924 12:9450859-9450881 ACCCACTCTGGCCGCGCTTGAGG - Intergenic
1093172292 12:15874515-15874537 GCCCATTCTGGCCACGCTTGAGG + Intronic
1093443841 12:19230829-19230851 GCCCACTCTGGCCGTGCCTGAGG - Intronic
1093524843 12:20093738-20093760 GCCCACTCTGGTGGTGCTTGAGG - Intergenic
1093583340 12:20807904-20807926 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1093654007 12:21674525-21674547 GCCCACCCTGGCCTCGCTTGAGG - Intronic
1093715444 12:22376790-22376812 GCCCACTCTGGCTGCGCTTGAGG + Intronic
1093741445 12:22693522-22693544 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1093921596 12:24865962-24865984 GCCCATTCTGACCGCGCTTGAGG + Intronic
1094108721 12:26839064-26839086 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
1094385519 12:29889087-29889109 GTCCACTCTGGCCGCGCTGGAGG - Intergenic
1094405424 12:30110923-30110945 GCCCACTCTGGCTGCGCTTGAGG - Intergenic
1094507032 12:31071214-31071236 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1094721998 12:33075233-33075255 GCCCACTCTGGCCGCACTTGAGG + Intergenic
1095478671 12:42611252-42611274 TCCCACTCTGGCCACGCTTGAGG - Intergenic
1095642315 12:44500283-44500305 ACCCACTCTGGCCATGCTTGAGG + Intergenic
1095642752 12:44502970-44502992 GTCCACTCTGGCCATGCTCGAGG - Intergenic
1097253617 12:57655654-57655676 GCCCACTTTGGCCATGCTTGAGG + Intergenic
1097490877 12:60269625-60269647 GTCCACTCTGGCCGCGCTTCAGG + Intergenic
1098498836 12:71166682-71166704 GCCCATTCTGGCCGCGCTTGAGG - Intronic
1098515918 12:71376743-71376765 GCCCATTCTGGCGGCGCTTGAGG + Intronic
1099190896 12:79561426-79561448 GCCCACTCCGGCCGCGCTTGAGG + Intergenic
1099192378 12:79573804-79573826 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1099204273 12:79710802-79710824 GCCCACTCTGGCCGCGCTTAAGG + Intergenic
1099228234 12:79993710-79993732 GCCCATTCTGGCTGTGCTTGAGG - Intergenic
1099413768 12:82361892-82361914 GCCCACTCTGGCCACGCTTGAGG - Intronic
1099443777 12:82728657-82728679 GCCCACTCTGGTCACGCTTGAGG + Intronic
1100078849 12:90823947-90823969 GTCCACTCTGGCCGTGCTCAAGG + Intergenic
1100142270 12:91633830-91633852 GCCCACTCTGGCCGCGCCTGAGG + Intergenic
1100166683 12:91924364-91924386 GCCCACTCTGGGTGCGCTTGAGG - Intergenic
1101603781 12:106232918-106232940 GCCCACTCTGGCGGCGCTTGAGG + Intergenic
1102024309 12:109704839-109704861 GCCCCCTCTGACCTGGCATGGGG - Intergenic
1102759831 12:115375565-115375587 GCCCCCTCTGTTCCTGCCTGAGG + Intergenic
1102903956 12:116660611-116660633 GCCCACTTTGGCCGCACTTGAGG + Intergenic
1103239165 12:119398511-119398533 GCCTACTCTGGCCGCGCTTGAGG - Intronic
1103347791 12:120263048-120263070 GCACCCTCTGGCCTTGCTACCGG + Intronic
1103497492 12:121374350-121374372 ACCCACTCTGGCCGCACTTGAGG + Intronic
1103710441 12:122908439-122908461 GGCCCCTCTGGCTGTTCATGGGG + Intergenic
1103760936 12:123249746-123249768 ATCCACTCTGGCTGTGCTTGAGG - Intronic
1103902049 12:124308476-124308498 GCCACCTCTGGCCGTGTTTTTGG + Intronic
1104021682 12:124996242-124996264 GCCCACACTGGCCAGGCTTGGGG + Intronic
1105593825 13:21817833-21817855 ACTCGCTCTGGCCGCGCTTGAGG + Intergenic
1105697289 13:22900879-22900901 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1105701599 13:22939112-22939134 GTCCACTCTGGCCACGCTTGAGG - Intergenic
1105747390 13:23391019-23391041 GCCACCACAGGCCGTGCCTGGGG + Intronic
1105871203 13:24507262-24507284 GCCCACTCTGGCTACGCTTGAGG - Intronic
1105883423 13:24623243-24623265 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1106162230 13:27212050-27212072 GTCCGCTCTGGCCACGCTTGAGG + Intergenic
1107652522 13:42559657-42559679 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1108362363 13:49678753-49678775 ATCCACTCTGGCCATGCTTGAGG - Intronic
1108685531 13:52815691-52815713 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1108686671 13:52826159-52826181 GTCCGCTCTGGCCACGCTTGAGG + Intergenic
1108750030 13:53439551-53439573 GTCCACTCTGGCTGCGCTTGAGG + Intergenic
1108845604 13:54676473-54676495 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1108991202 13:56659584-56659606 GCCCACTCTGGCTGTGCTTGAGG - Intergenic
1109111091 13:58319010-58319032 ACCCACTCTGGCCGTGTTTGAGG - Intergenic
1109201800 13:59439796-59439818 GCCCACACTGGCTGTGCTTGAGG + Intergenic
1109364561 13:61339052-61339074 GCCCATTCTGGCCGTGCTTGAGG + Intergenic
1109506083 13:63305633-63305655 GCCCATTCTGGCCGCGCCTGAGG + Intergenic
1109638161 13:65150032-65150054 GCCCGCTCTGGCCATGCTTGAGG - Intergenic
1109685908 13:65819316-65819338 GGCACCTCTGGACTTGCTTGGGG + Intergenic
1109699631 13:66009270-66009292 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
1109858758 13:68170865-68170887 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1110497798 13:76190000-76190022 GACCACTCTGGCCGCGCTTGAGG + Intergenic
1110609886 13:77475929-77475951 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1111006578 13:82257865-82257887 GCCCATTCTGGCTGCGCTTGAGG + Intergenic
1111138854 13:84086851-84086873 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1111220837 13:85204791-85204813 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1111333499 13:86792150-86792172 GCCCACTCTGGCAGCGCTTGCGG + Intergenic
1111556245 13:89884307-89884329 GCCCATTCTGGCCGCGCTTGAGG - Intergenic
1112077829 13:95931911-95931933 GTCCGCTCTGGCCATGCTCGAGG - Intronic
1112226431 13:97545162-97545184 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
1113297046 13:108970516-108970538 GCCCCCGCAGGCCTTGCCTGTGG - Intronic
1113330245 13:109319535-109319557 GTCCACTCTGGCCATGCTTGAGG - Intergenic
1113372028 13:109733129-109733151 GCCCATTCTGGCCGCGCTTGAGG - Intergenic
1113447035 13:110377256-110377278 GCCATCTCTGCCCTTGCTTGGGG + Intronic
1113995183 14:16058289-16058311 GGCCCGTCTGGCAGTGCTCGTGG + Intergenic
1114155470 14:20099072-20099094 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1114559583 14:23580521-23580543 GCCCACTCTGGCCAGGCTTGAGG + Intergenic
1114603303 14:23973459-23973481 ACCCACTCTGGCCACGCTTGAGG - Intronic
1114608281 14:24015941-24015963 ACCCACTCTGGCCATGCTTGAGG - Intergenic
1114679508 14:24473035-24473057 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1114957688 14:27845245-27845267 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
1115118222 14:29908882-29908904 ACCCACTCTGGCCACGCTTGAGG + Intronic
1115284184 14:31700431-31700453 GCCTACTCTGGCCATGCTTGAGG + Intronic
1115284971 14:31706070-31706092 GTCCACTCTGGCTGTGCTCGAGG - Intronic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1116223266 14:42113939-42113961 GCCCATTCTGGCCGCGCTTGGGG - Intergenic
1116426451 14:44798475-44798497 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1116569337 14:46495736-46495758 GCTTCCTCTGGCCTTGCCTGAGG - Intergenic
1116594311 14:46820320-46820342 GCCCATTCTGGCCGTGCTTGAGG + Intergenic
1116653707 14:47626442-47626464 ACTCACTCTGGCCGCGCTTGAGG + Intronic
1117742557 14:58833815-58833837 GCCCACTCTGGCCATGTTTGAGG + Intergenic
1118932296 14:70254606-70254628 GCCCACTCTGCCCACGCTTGAGG + Intergenic
1119027715 14:71167425-71167447 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1119303749 14:73590908-73590930 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1119554453 14:75542563-75542585 GTCCCCTCTGGCCCTCCTTGGGG - Intronic
1120169618 14:81235984-81236006 GTCCACTCTGGCCATGCTCGAGG + Intergenic
1120209943 14:81624240-81624262 GCCCATTCTGGCCGCACTTGAGG - Intergenic
1120215811 14:81679647-81679669 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1120229836 14:81829923-81829945 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1120632381 14:86905905-86905927 GCCCACTCTGGCCACGCTTGAGG - Exonic
1122405620 14:101499081-101499103 AGCCCCTCTGGCCATCCTTGTGG - Intergenic
1122514458 14:102297547-102297569 GCCCACTCTGGCCACGCTTGAGG + Intronic
1122894893 14:104751960-104751982 GCCCACTCTGGCCGCGCTCGAGG - Intergenic
1123438074 15:20270191-20270213 GGCCCCGCAGGCAGTGCTTGTGG + Intergenic
1124061654 15:26298537-26298559 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1124110663 15:26782100-26782122 GCCCACTCTGGCCACGCTTGAGG - Intronic
1124387910 15:29225221-29225243 GCCCACTCTGGCTGTGCTTGAGG - Intronic
1124404868 15:29383675-29383697 GCCCCCTGTGGAGGTGGTTGAGG - Intronic
1124720553 15:32107900-32107922 GCCCCTTCTGACCATGCCTGAGG - Intronic
1124972007 15:34496760-34496782 GCCCCCTCTTTCCGTCCTTCCGG + Intergenic
1125631531 15:41151564-41151586 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1125885613 15:43227023-43227045 GCCCATTCTGGCCGCGCTTGAGG - Intergenic
1126997515 15:54462341-54462363 GTCCACTGTGGCCATGCTTGAGG + Intronic
1127829161 15:62735142-62735164 GCCACCTCTGGAAGTGTTTGTGG + Intronic
1128141131 15:65301547-65301569 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1129158334 15:73732620-73732642 GCCCATTCTGGCCGCGCTTGAGG - Intergenic
1129196865 15:73973634-73973656 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1129392982 15:75229716-75229738 GCCCCCACTGGCCCTGGCTGAGG - Intergenic
1129586917 15:76876287-76876309 GTCCACTCTGGCCATGCTCGGGG - Intronic
1129724461 15:77894447-77894469 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1129726779 15:77905527-77905549 GACCCCTCTGGAGGTACTTGGGG - Intergenic
1130162302 15:81413929-81413951 GTCCGCTCTGGCCGCACTTGAGG + Intergenic
1130467163 15:84198236-84198258 GTCCCCTCTGGAGGTACTTGGGG - Intergenic
1130486450 15:84400949-84400971 GACCCCTCTGGAGGTACTTGGGG + Intergenic
1130497101 15:84475300-84475322 GTCCCCTCTGGAGGTACTTGGGG + Intergenic
1131005041 15:88971062-88971084 GTCCGCTCTGGCCACGCTTGAGG - Intergenic
1131012773 15:89032128-89032150 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1131250192 15:90825407-90825429 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1131261850 15:90891703-90891725 GCCACCTGTGGCAGGGCTTGGGG + Intronic
1131912516 15:97224133-97224155 GCCCACTCTGGCCTCGCTTGAGG + Intergenic
1131969232 15:97875623-97875645 GTCCGCTCTGGCCGCGCTGGAGG + Intergenic
1131992449 15:98104698-98104720 GCCCACTCTGGCTGCGCTTGAGG - Intergenic
1132044145 15:98549640-98549662 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1132155898 15:99495083-99495105 GCCCACTCTGGCCACACTTGAGG - Intergenic
1132516857 16:370038-370060 GCTCCCGCTGCCCGTTCTTGGGG + Exonic
1132643484 16:988419-988441 TCCCCCTCTGGCAGGGCTTGTGG + Intergenic
1133814334 16:9184636-9184658 TCCCACTCTGGCCGCGCTTGAGG - Intergenic
1134678204 16:16105101-16105123 ACCCACTCTGGCAGCGCTTGAGG - Intronic
1135470270 16:22723416-22723438 GTCCGCTCTGGCCATGCTCGAGG - Intergenic
1136111067 16:28063793-28063815 GCCCCCTCTCCCCGTGCGGGCGG - Intergenic
1137314509 16:47302509-47302531 TCCCACTTTGGCCGTACTTGAGG + Intronic
1137945638 16:52731304-52731326 GCCCACTCTGGCCACACTTGAGG + Intergenic
1138013978 16:53412709-53412731 GCCCGCTCTGGCCGAGCTCGAGG + Intergenic
1138168767 16:54829704-54829726 GCCCACTCTGGCCTTGCTCGAGG + Intergenic
1138352332 16:56352609-56352631 GCACCCTGTGGCTGAGCTTGGGG - Intronic
1138531100 16:57634856-57634878 GCCGCATCAGGCCATGCTTGTGG + Intronic
1138688702 16:58748735-58748757 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1139018952 16:62724757-62724779 GCCCACTCTGGTCGCGCTTGAGG + Intergenic
1139355854 16:66366748-66366770 GCCCCCACTCACCGTGCCTGTGG - Exonic
1139419992 16:66844317-66844339 GGCCTCTCTGGCCCTGCTGGGGG + Intronic
1139600237 16:67982162-67982184 GCCCACTCTGGCCGCGTTTGAGG + Intergenic
1139676355 16:68526634-68526656 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1140722595 16:77784852-77784874 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1141833153 16:86520996-86521018 GACCCCTGAGGCCCTGCTTGTGG + Intergenic
1141837649 16:86553321-86553343 GCCTACTCTGGCCGTGCTTGAGG + Intronic
1143135330 17:4709515-4709537 ACCCACTCTGGCCGCGCTTGAGG - Intergenic
1143552682 17:7640783-7640805 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1143708730 17:8718542-8718564 GCCCACTGTGGCCGTGCTTGAGG - Intergenic
1144128014 17:12220788-12220810 GCCCATTCTGGCCGCGCTTGAGG + Intergenic
1144572527 17:16408322-16408344 GTCCTCTCTGGCCCTGTTTGAGG + Intergenic
1144804731 17:17956944-17956966 GCCTTCTCTGGCTGTGCTTGAGG - Intronic
1144855324 17:18264293-18264315 GCTCACTGTGGCTGTGCTTGTGG + Exonic
1145094772 17:20016351-20016373 GCCCACTCTGGCCGCGCTTGAGG + Intronic
1147805277 17:43126726-43126748 GTCCATTCTGGCCGTGCTGGAGG + Intergenic
1149574732 17:57703452-57703474 GCCCACTCTGGCAGTGGTGGAGG - Intergenic
1149654516 17:58303146-58303168 GCGCCGTCTGGGCGGGCTTGAGG - Intronic
1149753908 17:59172410-59172432 GCCCACTCTGGCCAGCCTTGAGG + Intronic
1149916317 17:60613500-60613522 GCCTACTCTGGCTGCGCTTGAGG + Intronic
1150788193 17:68179734-68179756 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
1150792176 17:68207743-68207765 GCCCACTCTGGGCGCGCTTGAGG + Intergenic
1151438575 17:74113783-74113805 GCCCACTGTGGCCGCGCTTGAGG - Intergenic
1151567535 17:74907516-74907538 GCCCACTCTGGCCACACTTGAGG - Intergenic
1151866358 17:76806016-76806038 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1151957313 17:77386811-77386833 GTACCCTCTGGCTGTGCTGGGGG + Intronic
1152943669 17:83186383-83186405 GCCCCCTCTGGCAGCTCGTGAGG + Intergenic
1152943678 17:83186412-83186434 GCCCCCTCTGGCAGCTCGTGAGG + Intergenic
1153070309 18:1098112-1098134 GCCCATTCTGGCCGCACTTGAGG + Intergenic
1153820064 18:8825154-8825176 GCTCCCTCTGGCTCTGCTTGTGG - Exonic
1153868627 18:9296735-9296757 GTCCACTCTGGCCATGCTTGAGG + Intergenic
1154057315 18:11024120-11024142 GCCCACTCAGGCCGCGCTTGAGG - Intronic
1154231498 18:12559561-12559583 GTCCACTCTGGCCATGCTTGAGG - Intronic
1154294174 18:13135142-13135164 GTCCACTCTGGCTGCGCTTGAGG - Intergenic
1155169598 18:23257566-23257588 ACCTCCTCTTCCCGTGCTTGAGG - Exonic
1155806373 18:30175592-30175614 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1156079442 18:33316114-33316136 GCCCACTCTGGCGGAGCTTGAGG + Intronic
1156119146 18:33820707-33820729 GTCCGCTCTGGCCGCGCTGGAGG - Intergenic
1156610554 18:38718856-38718878 GCCCACTCTGGCCGCACTTGAGG - Intergenic
1156651883 18:39235233-39235255 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1156657760 18:39308979-39309001 ATCCACTCTGGCCGTGCATGAGG + Intergenic
1156683502 18:39618344-39618366 GCCCACTCTGGTCATGCTTGAGG + Intergenic
1156969606 18:43139408-43139430 GCCCTCTCTGGCCGCACTTGAGG + Intergenic
1157545917 18:48546397-48546419 GCCCCTTTTGGACGTGCTTATGG - Intronic
1157621715 18:49020847-49020869 GCCGCCTCTGTCCGTGCTGGTGG - Intergenic
1157935251 18:51864841-51864863 GCCCACTCTGGCCACACTTGAGG - Intergenic
1158282370 18:55841169-55841191 GCCCACTCTGGCCGCACTTGAGG - Intergenic
1158460798 18:57644088-57644110 GCCTACTCTGGCGGTGCTTGAGG - Intergenic
1158553806 18:58459277-58459299 GCCCACTCTGGCGGCGCTGGAGG + Intergenic
1159656276 18:71032180-71032202 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1159670281 18:71212952-71212974 GCCCACTCTGGCCACACTTGAGG - Intergenic
1160832768 19:1111370-1111392 GCCCTCTCTGTCCGTGTGTGGGG + Intronic
1160905756 19:1451061-1451083 GCTCCCTCTGGCTGTGCATGGGG + Intronic
1161222069 19:3122421-3122443 TCCCCCTCGGGCCGTGGTCGTGG - Exonic
1161316696 19:3620627-3620649 GCCCCCTTTGGCAGGACTTGAGG - Intronic
1162091155 19:8280826-8280848 GTCCACTCTGGCCGCGCTTGAGG - Intronic
1162093389 19:8295664-8295686 GTCCACTCTGGCCGCGCTTGAGG - Intronic
1162831068 19:13285035-13285057 GCCCCCCCTGCCCTTGCTGGGGG + Intronic
1162987038 19:14277522-14277544 GCCCACTCTAGCCGCGCTTGAGG + Intergenic
1163412250 19:17162487-17162509 GCCTCCCCTGGCCGGGCTTGAGG - Intronic
1163747695 19:19057889-19057911 GCCCCCTCTGGTAGGGCGTGGGG - Exonic
1164492989 19:28731297-28731319 GCCCACACAGGCCGTGGTTGGGG - Intergenic
1164581903 19:29439904-29439926 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1164850242 19:31477248-31477270 GCCCCCTGTGGTCCTGCTTCTGG + Intergenic
1165490173 19:36118860-36118882 GCCCCCTCTGGCTGTGTGTGGGG + Intronic
1165846518 19:38821383-38821405 GCCCACTCTGGCCATGCTTGAGG + Intronic
924967314 2:90878-90900 ACCCACTCTGGCTGTGCTTGAGG + Intergenic
925172674 2:1759785-1759807 GCCTACTCTGGCCACGCTTGAGG - Intergenic
926097420 2:10091288-10091310 GCCCATTCTGGCCACGCTTGAGG + Intergenic
926437733 2:12854544-12854566 GCCCACTCTGGCCGGGCTTGAGG - Intergenic
926474841 2:13308765-13308787 GCCCACTCTGGCCGCTCTTGAGG - Intergenic
927208873 2:20626727-20626749 CCACCCTCAGGCCCTGCTTGTGG + Intronic
927596523 2:24402746-24402768 GTCCACTCTGGCTGCGCTTGAGG + Intergenic
927942252 2:27111941-27111963 GCCCACTCTGGCCGCGCTTGAGG - Intronic
928106300 2:28472584-28472606 GCCCACTCTGGCCACGCTTGAGG + Intronic
928599252 2:32887041-32887063 ATCCACTCTGGCCATGCTTGAGG - Intergenic
928618012 2:33057901-33057923 GCCCATTCTGGCCGTGCTTGAGG - Intronic
928688491 2:33775235-33775257 GTCCACTCTGGCCGTGCTTGAGG + Intergenic
928701609 2:33903986-33904008 GCCCACTCTGGCGGCACTTGAGG - Intergenic
928723180 2:34142981-34143003 GCCCACTCTGGCTGCACTTGAGG - Intergenic
928880512 2:36092127-36092149 GCCCACTCTGGCCGCACTTGAGG + Intergenic
929109803 2:38397197-38397219 GCCCACTCTGGCCACGCTTGAGG + Intergenic
929138084 2:38643535-38643557 ACCCACACTGGCCGCGCTTGAGG - Intergenic
930420954 2:51152094-51152116 GCCCACTCTGGCCACGCTTGAGG - Intergenic
930585235 2:53259972-53259994 ACACGCTCTGGCCGTGCTCGAGG - Intergenic
930593337 2:53356325-53356347 GTCCACTCTGGCCGCACTTGAGG + Intergenic
932178211 2:69621969-69621991 GCCCACTCTGGCCGTGCTTGAGG + Intronic
932423548 2:71615132-71615154 TCTGCCTCTGGCTGTGCTTGTGG - Intronic
932618981 2:73254932-73254954 CACCCCTCTGCCTGTGCTTGGGG + Exonic
932983539 2:76698594-76698616 GCCCACTCTGGCCACGCTTGAGG - Intergenic
933049856 2:77590377-77590399 ACCCACTCTGGCCGCACTTGAGG + Intronic
933139734 2:78778878-78778900 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
933415756 2:81985061-81985083 ATCCACTCTGGCTGTGCTTGAGG + Intergenic
933491124 2:82986195-82986217 GTCCACTCTGGCCATGCCTGAGG - Intergenic
933506260 2:83180929-83180951 GCCCATTCCGGCCGCGCTTGAGG + Intergenic
933514980 2:83289271-83289293 GCTCCCTCTGAAGGTGCTTGGGG - Intergenic
933531572 2:83518058-83518080 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
934085065 2:88503052-88503074 GCTCACTCTGGCCGCGCTTGAGG + Intergenic
934479597 2:94622658-94622680 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
935790244 2:106584305-106584327 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
935866371 2:107392166-107392188 GCCCACTCTGGCCATGCTTGAGG + Intergenic
935872886 2:107469816-107469838 GTCCACTCTGGCCATGCTTGAGG - Intergenic
935878427 2:107536563-107536585 GCCCACTTTGGCCATGCTCGAGG - Intergenic
935922484 2:108031449-108031471 GTCCACTTTGGCCATGCTTGAGG + Intergenic
936865477 2:117072047-117072069 GCCCACTCTGGCCACACTTGAGG - Intergenic
937789493 2:125943399-125943421 ACCCATTCTGGCCATGCTTGAGG - Intergenic
938177252 2:129144715-129144737 GTCCGCCCTGGCCGTGCTTGAGG - Intergenic
939003066 2:136758347-136758369 GCCCACTCTGGCCACGCTTGAGG + Intergenic
939085608 2:137715683-137715705 GCCCACTCTGGCCGCACTTGAGG + Intergenic
939745459 2:145960975-145960997 GTCTGCTCTGGCCATGCTTGAGG - Intergenic
940145861 2:150543018-150543040 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
940453767 2:153872001-153872023 GTCCGCTCTGGCCGCGCTCGAGG + Exonic
941476661 2:165957542-165957564 GTCCACTCTGGCAGTGCTTGAGG - Intergenic
942170328 2:173283062-173283084 GCCCACTCTGGCTGCACTTGAGG - Intergenic
942317671 2:174710042-174710064 GCCCATTCTGGCCGAGCTTGAGG - Intergenic
942368732 2:175257477-175257499 GCCCACTCTGGCAGCGCTTGAGG - Intergenic
942540115 2:177007734-177007756 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
943134369 2:183892420-183892442 ATCCACTCTGGCTGTGCTTGAGG + Intergenic
943166145 2:184328127-184328149 GCCCACTCTGGCCATGCTTGAGG - Intergenic
943222767 2:185132495-185132517 ACCCACTCTGGCCGCGCCTGAGG + Intergenic
943365225 2:186962154-186962176 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
943941505 2:194003211-194003233 GCCCACTCTGGCCATGCTTGAGG - Intergenic
943954841 2:194176199-194176221 GCCCATTCTGGCCGCGCTTGAGG + Intergenic
944055124 2:195515566-195515588 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
944058554 2:195547786-195547808 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
944252557 2:197592031-197592053 GCCCACTCTGGCCACACTTGAGG - Intronic
945069580 2:205977116-205977138 GCTCACTCTGGCCGCGCTTGAGG + Intergenic
945401328 2:209387265-209387287 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
945451550 2:210001042-210001064 ACCCACTCTGGCCGCGCTTGAGG - Intergenic
945744247 2:213701443-213701465 GTCCACTCTGGCCACGCTTGAGG + Intronic
945907959 2:215615360-215615382 GTCCACTCTGGCTGCGCTTGAGG - Intergenic
946053925 2:216885135-216885157 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
946152834 2:217787730-217787752 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
946376432 2:219312706-219312728 GCCCACTCTGGCCGAGCTTGAGG + Intergenic
947539429 2:230964726-230964748 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
947938092 2:234024756-234024778 GCCCATTCTGGCCGTGCTTGAGG - Intergenic
947961976 2:234247562-234247584 GCCCACTCTGGCCGCGCTTGTGG + Intergenic
948545212 2:238723175-238723197 GTCCACTCTGGCCGCGCTCGAGG - Intergenic
948686026 2:239670223-239670245 CCACCTTCTGGCCTTGCTTGGGG - Intergenic
949009030 2:241668068-241668090 GCCCCCTATGGCAGTGGGTGGGG + Intronic
1168854394 20:998563-998585 GCCCTCTCTGAGCCTGCTTGAGG - Intronic
1169091859 20:2865732-2865754 GCCCCCTGTGGCCCTCCCTGGGG - Intronic
1169630294 20:7622920-7622942 GTCCACTCTGGCGGTGCTTGAGG - Intergenic
1170230939 20:14045257-14045279 GCCCACTCTGGCTGCGCTTGAGG - Intronic
1170649432 20:18226651-18226673 ACCCACTCTGGCCCTGCTTGAGG + Intergenic
1170930816 20:20768325-20768347 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1171810110 20:29740829-29740851 GGCCCGTCTGGCAGGGCTTGTGG - Intergenic
1171973505 20:31579035-31579057 GCCCACTCTGGCTGCGCTTGAGG - Intergenic
1174162954 20:48564537-48564559 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1175166662 20:57048885-57048907 ACCCCCTCTGGAGGAGCTTGGGG + Intergenic
1175390501 20:58624358-58624380 GGCCTCTCTGGCCTTGCTTGAGG + Intergenic
1175908602 20:62393951-62393973 CCCCCGCCTGGCCGTGCCTGAGG - Intronic
1176030068 20:63007466-63007488 GCGCCCTGTGGCCAGGCTTGAGG + Intergenic
1176189311 20:63800449-63800471 GCCCACTCTGGCTGCACTTGAGG + Intronic
1176344891 21:5733930-5733952 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1176351705 21:5854514-5854536 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1176499936 21:7590525-7590547 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1176539212 21:8132000-8132022 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1176558163 21:8315045-8315067 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1176663158 21:9659921-9659943 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1176663778 21:9664528-9664550 GCCCACTCTGGCCGCATTTGAGG - Intergenic
1176872314 21:14093444-14093466 GCCTACTCTGGCCACGCTTGAGG - Intergenic
1177182467 21:17758061-17758083 GCCCACTCTGCCTGTGCTTGAGG - Intergenic
1177318661 21:19493495-19493517 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
1177581029 21:23021805-23021827 GTCCGCTCTGGCCGCGCTTGAGG - Intergenic
1177669721 21:24209142-24209164 GTCCACTCTGGCCATGCTCGAGG - Intergenic
1177795834 21:25778253-25778275 GCCCACTCTCGCCGCGCTTGAGG + Intergenic
1178054465 21:28783642-28783664 ACCCACTCTGGCCATGCATGAGG + Intergenic
1178619082 21:34158597-34158619 CCACCCTCTGGCCATGCCTGGGG - Intergenic
1179930564 21:44568511-44568533 TCCCCCTCTGGGCGTGCCAGGGG + Intronic
1180311909 22:11249120-11249142 GGCCCGTCTGGCAGTGCTCGTGG - Intergenic
1180614608 22:17119529-17119551 GCCCCCTCTGGCCCGACTCGGGG + Exonic
1180755025 22:18155411-18155433 GCCCACTCTGGCCACGCTTGAGG + Intronic
1181077733 22:20392831-20392853 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1181273721 22:21675700-21675722 GCCCCCTCTGGCTGAGGCTGTGG + Intronic
1181450622 22:23017493-23017515 GCCCACTCTGGCCCCGCTTGAGG - Intergenic
1181800947 22:25347381-25347403 GCCCACTCTGACCACGCTTGAGG - Intergenic
1181851427 22:25752746-25752768 GTCCACTCTGGCCATGCTTGAGG + Intronic
1182338091 22:29598496-29598518 ACCCACTCTGGCCGCGCTTGAGG - Intergenic
1182479313 22:30596746-30596768 GCCCATTCTGGCCACGCTTGAGG + Intronic
1183082081 22:35463130-35463152 TGCCACTCTGGCCCTGCTTGAGG + Intergenic
1183314255 22:37128411-37128433 GCCCCCAGGGGCAGTGCTTGGGG + Exonic
1183990286 22:41593412-41593434 GCCCATTCTGGCCGTGCTTGAGG + Intergenic
1185058580 22:48593715-48593737 GCCCCAGCTGGCCTTCCTTGGGG - Intronic
1185225497 22:49649476-49649498 GCCCTCCCTGGCTGTGCCTGGGG - Intronic
1185370712 22:50459725-50459747 GGCTCCTCTTGCCCTGCTTGGGG - Intronic
1203244160 22_KI270733v1_random:48355-48377 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
949281424 3:2352280-2352302 GTCCACTCTGGCCGCACTTGAGG + Intronic
949292688 3:2484800-2484822 GCCCACTCTGGCCATGCTCGAGG + Intronic
949769918 3:7568484-7568506 GCCCACTCTGGCCACACTTGAGG + Intronic
950156256 3:10723718-10723740 GCCCCCTCTGGCTGTACTGCAGG + Intergenic
950203533 3:11061268-11061290 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
950204919 3:11071697-11071719 ACCCACTCTGGCCGTGCTTGAGG - Intergenic
950401084 3:12769334-12769356 GCCCACTCTGGCCGCACTTGAGG - Intronic
950418482 3:12882777-12882799 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
950601162 3:14037084-14037106 GTCCACTCTAGCCATGCTTGAGG + Intronic
951024932 3:17818159-17818181 GCCCACTCTGGCCACGCTTGAGG - Intronic
951025007 3:17818466-17818488 ACCCACTCTGGCCTCGCTTGAGG - Intronic
951415372 3:22416838-22416860 GCCCACACTGGCCATGCTTGAGG + Intergenic
951551944 3:23883009-23883031 GCCCACTCTGGCCGCGCTTGAGG - Intronic
952011342 3:28903640-28903662 ACCCACTCTGGCTGCGCTTGAGG - Intergenic
952076251 3:29701463-29701485 GCCCACTCTGGCCGTGCTTGAGG + Intronic
952360398 3:32625525-32625547 GGCCACTCTGGCCGCGCTTGAGG + Intergenic
952453634 3:33453345-33453367 GCCCACTCTGGCCATGCTTAAGG + Intergenic
953096208 3:39779636-39779658 GTCCGGTCTGGCCATGCTTGAGG + Intergenic
953422971 3:42769599-42769621 GCCCACTCTGGCGGTGCTTGAGG + Intronic
953714529 3:45306554-45306576 GCCCACTCTGGTCACGCTTGAGG + Intergenic
954089396 3:48272397-48272419 GTCCGCTCTGGCCACGCTTGAGG - Intronic
954230619 3:49213913-49213935 GTCCACTCTGGCCATGCTTGAGG - Intronic
954377701 3:50203758-50203780 GCTCCCACTGGCAGTTCTTGAGG - Intergenic
955219602 3:57012770-57012792 GCCCACTCTGGCCACACTTGAGG + Intronic
956184010 3:66545128-66545150 GCCCACTCTGGCAGCGCTTGAGG - Intergenic
956459157 3:69454323-69454345 GCCCACTCTGGCCGCACTTGAGG + Intronic
956479556 3:69660553-69660575 GTCCACTCTGGCCAGGCTTGAGG + Intergenic
956563566 3:70611742-70611764 ACCCACTCTGGCCACGCTTGAGG + Intergenic
956632533 3:71331020-71331042 GCCCACTCTGGCCGCGCTTGAGG + Intronic
956986899 3:74711943-74711965 GCCCATTCTGGCCACGCTTGAGG + Intergenic
957209498 3:77240558-77240580 GTCCGCTCTGGCCACGCTTGAGG - Intronic
957323451 3:78662064-78662086 GCTCTCTCTGGACCTGCTTGTGG + Exonic
957386378 3:79502143-79502165 GCCCACTCTGGCCGCGCTTGAGG + Intronic
957885435 3:86282136-86282158 GCCCACTCTGGCCACGCTTCAGG + Intergenic
957919724 3:86731902-86731924 GCCTACTCTGGCCATGCCTGAGG - Intergenic
957970318 3:87375205-87375227 GCCCGCTCTGGCCACACTTGAGG + Intergenic
958548654 3:95589011-95589033 GTCCACTCTGGCCATGCTTGAGG - Intergenic
958627712 3:96646866-96646888 GTTCGCTCTGGCCATGCTTGAGG - Intergenic
960479472 3:118171284-118171306 GCCCACTCTGGCCGTGCCTGAGG + Intergenic
960487250 3:118269568-118269590 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
960560108 3:119073874-119073896 GCCCACTCTGGCCATGATTGAGG - Intronic
960669137 3:120140140-120140162 GCCCACTCTGGCTGCGCTTGGGG + Intergenic
960685436 3:120289602-120289624 TCCCACTCTGGCTGTGCTTGAGG + Intergenic
960808926 3:121610177-121610199 GCTTCCTCTGGCAGGGCTTGGGG + Intronic
960868648 3:122227650-122227672 TCCCACTGTGGCCGTGCTTGAGG - Intronic
961012814 3:123447720-123447742 GCCCTACCTGGCCGTGCTGGCGG - Exonic
961268708 3:125671564-125671586 GCCCACTCTGGCCGCACTCGAGG + Intergenic
961465115 3:127076715-127076737 GCCCACTCTGGCCACGCTTGAGG - Intergenic
961666701 3:128497340-128497362 GCTCCCGCCGGGCGTGCTTGGGG + Intergenic
961688725 3:128653281-128653303 GCCCACTCTGGCCGCGCTTGAGG + Intronic
961700865 3:128743397-128743419 GTCTGCTCTGGCCATGCTTGAGG - Intronic
961746796 3:129068753-129068775 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
962177313 3:133167863-133167885 GCCCACTCTGGCCACACTTGAGG - Intronic
962383838 3:134916834-134916856 ACCCATTCTGGCCGCGCTTGAGG - Intronic
962671756 3:137714973-137714995 GCCCACTCTGGCGGCGCTTGAGG - Intergenic
962998066 3:140651310-140651332 GCCTATTCTGGCCGCGCTTGAGG + Intergenic
963533197 3:146497185-146497207 GCCCACTCTGGCCACACTTGAGG + Intergenic
963554586 3:146772232-146772254 ACCCACTCTGGCCGCACTTGAGG + Intergenic
963744089 3:149109271-149109293 GCCCATTCTGGCCATGCTTGAGG + Intergenic
964064003 3:152559336-152559358 GTCCACTCTGGCCATGCTCGGGG + Intergenic
964138428 3:153370233-153370255 ATCCACTCTGGCCATGCTTGAGG - Intergenic
964198095 3:154087923-154087945 GCCCACTCTGGCGGCACTTGAGG + Intergenic
964265447 3:154889714-154889736 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
964374983 3:156041205-156041227 GCCCACTCTGGCCGTGCTTGAGG + Intronic
964751789 3:160060410-160060432 GCCCACTCTGGCCACACTTGAGG + Intergenic
964993566 3:162845073-162845095 ACCCACTCTGGCCATGCTTGAGG - Intergenic
965092179 3:164179139-164179161 GCCCACTCTGGCCACGCATGAGG + Intergenic
966108284 3:176362697-176362719 GCCCACTCTGGCAGCGCTTGAGG - Intergenic
966183098 3:177204372-177204394 GCCCACTCTGGCCACGCTCGAGG - Intergenic
966186222 3:177229034-177229056 GCCCATTCTGGCTGCGCTTGAGG - Intergenic
966246145 3:177809370-177809392 GCCCACTCTGGTCGCACTTGAGG - Intergenic
966372479 3:179263453-179263475 GCCCACTCTGGCCGCGCCTGAGG - Intronic
967234171 3:187368043-187368065 GCCCACTCTGGCCGCGCTGGAGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968733057 4:2280739-2280761 GCACCCTCGGGCCCTGCCTGTGG + Intronic
969289322 4:6228531-6228553 GGCCCCATTGGCCATGCTTGTGG - Intergenic
969303246 4:6309530-6309552 GCCCCCTCTGGCCGCGCTTCAGG - Intergenic
969470960 4:7389072-7389094 GCCCCCACGGGCAGTGCGTGTGG + Intronic
970108248 4:12609520-12609542 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
970272056 4:14358552-14358574 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
970408701 4:15787179-15787201 GCCCACTCTGGCCGTGCTTGAGG - Intronic
970615829 4:17767280-17767302 GCCCACTCTGGCCACGCTTGAGG - Intronic
970692060 4:18631045-18631067 ATCCACTCTGGCTGTGCTTGAGG - Intergenic
970817952 4:20179496-20179518 GCCCTCTCTGGCCGCACTTGAGG - Intergenic
970993309 4:22237342-22237364 GCCCCCTGTGGGCATGCATGTGG - Intergenic
971043411 4:22779054-22779076 GTCCACTCTGGCCGTACTTGAGG - Intergenic
971209194 4:24599590-24599612 GTCCCTCCTGGCCGTGCTTGAGG - Intergenic
971280600 4:25239706-25239728 GCCCACTCTGGCCGCACTTGAGG - Intronic
971281749 4:25247089-25247111 GCCCACTCTGGCCGTGCCTGAGG - Intronic
971618696 4:28827883-28827905 GCCCACTCTGGCCGCACTTGAGG + Intergenic
971635038 4:29047403-29047425 GCCCACTCTGGCCGGACTTGAGG + Intergenic
971722510 4:30264576-30264598 GTCCACTCTGACCGTGCTTGAGG + Intergenic
971792420 4:31185444-31185466 GTCCACTCTGGCCACGCTTGAGG - Intergenic
972173311 4:36374816-36374838 GTCCACTCTGGCAGTGCTTGAGG + Intergenic
972361006 4:38325383-38325405 GCCCACTCTGGCCATGCTTGAGG - Intergenic
972790803 4:42369576-42369598 CTCCGCTCTGGCCGTGCTGGAGG + Intergenic
972890406 4:43551100-43551122 GCCCACTCTGGCCACACTTGAGG + Intergenic
973041867 4:45477824-45477846 ACCTACTCAGGCCGTGCTTGAGG - Intergenic
973142026 4:46781563-46781585 GTCCACTCTGGCCACGCTTGAGG + Intronic
973144325 4:46805264-46805286 GCCCACTCTGGCCCCACTTGAGG - Intronic
973146241 4:46830927-46830949 GCCCACTCTGGCCGCACTTGAGG + Intronic
973764362 4:54149711-54149733 GTCCACTCTGGCCGCGCTTGAGG - Intronic
973878056 4:55241389-55241411 GCCCACTCTGGCTGCACTTGAGG + Intergenic
974089950 4:57300643-57300665 GCCCACTCTGGCCATGCTTGAGG - Intergenic
974207385 4:58724022-58724044 GCTCACTCTGGCTGCGCTTGAGG + Intergenic
974807630 4:66899933-66899955 GCCCACTCTGGCTGCGCTTGAGG - Intergenic
974838296 4:67275717-67275739 GCCCACTCTGGCCATTCTTGAGG - Intergenic
974839406 4:67283294-67283316 GCCCACTGGGGCCATGCTTGAGG - Intergenic
974839856 4:67287170-67287192 GTCCACTCTGGCCGCACTTGAGG - Intergenic
974892362 4:67897034-67897056 GCCCACTCTGGCCGCACTTGAGG - Intergenic
975160634 4:71120814-71120836 GCCCACTCTGGCTGCACTTGAGG + Intergenic
975744890 4:77466272-77466294 GCCCACTCTGGCCATGCTTGAGG + Intergenic
975994876 4:80302724-80302746 GCCCACACTGGTCGTGCTTGAGG + Intronic
976690683 4:87864150-87864172 GCCCACTCTCGCTGCGCTTGAGG - Intergenic
976736353 4:88313619-88313641 GCCCACTTTGGCCGTGCTTGAGG - Intergenic
977206447 4:94169727-94169749 ACCCACTCTGGCGGTGGTTGAGG + Intergenic
977400008 4:96521010-96521032 GTCCACTCTGGCTGCGCTTGAGG + Intergenic
977416614 4:96742464-96742486 GCCCACACTGGCCGCGTTTGAGG + Intergenic
977470766 4:97438558-97438580 GCCCACTCTGGCCACGCTTGAGG - Intronic
977507678 4:97923140-97923162 GCCCACTCTGGCCATGCTTGAGG + Intronic
977606998 4:98993956-98993978 TCCCATTCTGGCCGTGCTTGAGG - Intergenic
977880448 4:102198351-102198373 GCTCCCTCTGTCTGTCCTTGTGG + Intergenic
977883534 4:102234226-102234248 GCCCACTCTGGCCACACTTGAGG + Intergenic
977885833 4:102250760-102250782 GCCCACTGTGGCCGTGCTTGAGG - Intergenic
978030525 4:103936664-103936686 GCCCACTCTGGCAGCACTTGAGG + Intergenic
978254955 4:106681928-106681950 GCCCACTCTGGCCATGCTTGAGG - Intergenic
978514541 4:109557297-109557319 GTCCGCTCTGGCCATGCTTGAGG + Intergenic
978886481 4:113772222-113772244 GTCCGCTCTGGCCATGCTTGAGG + Intergenic
978918043 4:114149031-114149053 GCCCACTCTGGCCGTGCTAGAGG - Intergenic
979445739 4:120809040-120809062 GCCCGCTCTGGCCATGCTTGAGG - Intronic
979608951 4:122670114-122670136 GCCCACTCTGGTCGTGCTTGAGG + Intergenic
979678677 4:123435843-123435865 GCCCACTCTGGCCATGCTTGAGG - Intergenic
979780880 4:124650629-124650651 GTCCGCTCTGGCTGCGCTTGAGG + Intergenic
979920395 4:126489906-126489928 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
979949574 4:126874911-126874933 GCCCACTCTGGCCATGCTTGAGG - Intergenic
980234692 4:130090472-130090494 GTCCGCTCTGGCAGTGCTCGAGG + Intergenic
980328389 4:131379250-131379272 GTCCGCTCTGGCCGCGCTGGAGG + Intergenic
980562871 4:134501556-134501578 GCCTACTCTGGCCATGCTTGAGG + Intergenic
980698678 4:136395234-136395256 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
980739190 4:136928893-136928915 GCCCACTCTGGCTGCACTTGAGG + Intergenic
980809182 4:137853513-137853535 GTCCGCTCTGGCCGCGCTTGAGG + Intergenic
980824172 4:138053374-138053396 GCCCACTCTGGCTGCACTTGAGG - Intergenic
980827413 4:138089168-138089190 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
981558532 4:146022660-146022682 GGCACCTCTGGACCTGCTTGGGG - Intergenic
982024281 4:151236132-151236154 GTCCGCTCTGGCCGCGCTGGAGG + Intronic
982293746 4:153806154-153806176 GTCCGCTCCGGCCGTGCTCGAGG + Intergenic
982647609 4:158044058-158044080 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
982692710 4:158566830-158566852 GCCCATTCTGGCCGGGCTTGAGG + Intronic
982863310 4:160481656-160481678 GCCCACTCTGACCGCGCTTGAGG + Intergenic
982921199 4:161277129-161277151 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
982985690 4:162203475-162203497 GCCCACTCTGGCTGTGCTTAAGG + Intergenic
983290724 4:165799860-165799882 GCGCACTCTGGCCATGCATGAGG - Intergenic
983425637 4:167581449-167581471 GTCCACTCTGGCCATGCTTGAGG + Intergenic
983656666 4:170091117-170091139 GCTCACTCTGACCGCGCTTGAGG + Intronic
983835460 4:172378013-172378035 ATCCACTCTGGCCATGCTTGAGG - Intronic
984069223 4:175091998-175092020 ACCCACTCTGGCCACGCTTGAGG + Intergenic
984728594 4:183044964-183044986 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
984805413 4:183746913-183746935 GCCCACTCTGGCCGAGCTTGAGG - Intergenic
984918036 4:184741094-184741116 GCCCACTCTGGCCATGCTTGAGG + Intergenic
985323036 4:188735371-188735393 GTCCACTCCGGCCATGCTTGAGG - Intergenic
985324642 4:188754384-188754406 GCCCCCTCTGGCCGCGCTTGAGG + Intergenic
985403665 4:189615695-189615717 GCTCACTCTGGCCCTGCTTGAGG - Intergenic
985412164 4:189696128-189696150 GCCCACTCTGGCCATGCTTGAGG - Intergenic
985642336 5:1069485-1069507 GCCCCCTCTGTCCTTGCTGTGGG - Intronic
985702251 5:1380605-1380627 GTCGGCTCTGGCCGTGCTTGAGG - Intergenic
986121067 5:4837429-4837451 GCCCACTCTGGCCACACTTGAGG + Intergenic
986963529 5:13244091-13244113 ACCCACTCTGGCTGCGCTTGAGG + Intergenic
987099117 5:14577155-14577177 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
987355777 5:17062104-17062126 GCCCATTCTGGCCGCACTTGAGG + Intergenic
987696530 5:21341282-21341304 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
988143127 5:27267671-27267693 GCCCACTCTGGCCATGCTTGAGG - Intergenic
988201847 5:28078126-28078148 GCCCACTCTGGCGGCACTTGGGG - Intergenic
988721595 5:33884399-33884421 GCCACTCCTGGCCGTGCTTTTGG + Intronic
988755670 5:34245288-34245310 GCCCACTCTGACCGCGCTTGAGG - Intergenic
989207093 5:38821783-38821805 GTCCGCTCTGGCCGCACTTGAGG + Intergenic
989559616 5:42836254-42836276 ATCCACTCTGGCCATGCTTGAGG + Intronic
990243191 5:53836857-53836879 GCCCACTCTGGCCGCACTTGAGG + Intergenic
990323254 5:54649490-54649512 GCCCATTCTGGCCATGCTTGAGG - Intergenic
990512222 5:56499129-56499151 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
990869404 5:60415342-60415364 GCCCACTCTGGCCGTGCTTGAGG + Intronic
990880159 5:60530206-60530228 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
991427033 5:66503177-66503199 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
991505364 5:67318749-67318771 GCCTGCTCTGGCCACGCTTGAGG + Intergenic
991657732 5:68920762-68920784 GCCCACTCTGGCCACACTTGAGG + Intergenic
991743922 5:69711059-69711081 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
991753787 5:69844183-69844205 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
991795494 5:70290791-70290813 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
991803404 5:70400910-70400932 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
991823292 5:70586327-70586349 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
991833103 5:70719296-70719318 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
991887861 5:71290310-71290332 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
992048797 5:72925378-72925400 CTCCACTCTGGCCGTGCTTGAGG + Intergenic
992803044 5:80310424-80310446 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
992890794 5:81202214-81202236 ACGTCCTCTGTCCGTGCTTGGGG + Intronic
993202267 5:84830753-84830775 GTCCACTCTGGCCACGCTTGAGG - Intergenic
993678667 5:90847932-90847954 GCCCACTCTGGCCGCGCTTGAGG - Intronic
993803610 5:92375357-92375379 GCCCATTCTGGCCACGCTTGAGG - Intergenic
994166951 5:96618398-96618420 GTCCACTCTGGCCATGCTTGAGG + Intronic
994239801 5:97407069-97407091 GCCCACTCTGGCGGCGCTTGAGG + Intergenic
994251597 5:97542352-97542374 GCCCACTCTGGCCGCCCTTGAGG - Intergenic
994620265 5:102154827-102154849 GCCCATTCTGGCCGCGCTTGAGG + Intergenic
994647821 5:102491820-102491842 GCCCACTCTGGCCATGCTTGAGG - Intronic
994669682 5:102751954-102751976 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
994843266 5:104952313-104952335 GCCTCCTTTGGCTGTGTTTGGGG + Intergenic
994932501 5:106206518-106206540 GCCCACTCTGGCCACGCTTGAGG - Intergenic
995112442 5:108442512-108442534 ACCCATTCTGGCCATGCTTGAGG - Intergenic
995975747 5:118033682-118033704 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
995988507 5:118208421-118208443 GCCCACTCTGGCTGCGCTTAAGG - Intergenic
996298624 5:121954426-121954448 GCCCACTCTGGCCGCACTTGAGG - Intergenic
996478764 5:123949661-123949683 GTCCACTCTGGCCATGCTTGAGG - Intergenic
996567127 5:124892313-124892335 GTCCACTTTGGCCATGCTTGAGG + Intergenic
996747166 5:126855003-126855025 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
997329266 5:133047432-133047454 GTCCACTCTGGCCATGCTCGAGG + Intergenic
997352147 5:133238878-133238900 TCCCACTCTGGCCATGCTTGAGG + Intronic
997375434 5:133394240-133394262 GCCCACTCTGGCCATGCTTGAGG + Intronic
997725256 5:136114828-136114850 GCCCTCTCTTGCTGTGCTTTTGG + Intergenic
998117471 5:139549230-139549252 GTCCACTCTGGCTGCGCTTGAGG + Intronic
998131241 5:139652054-139652076 GCCCCCTGGGGCCCTGATTGGGG + Intronic
999754265 5:154652985-154653007 CCCCCCTCTGTCTGTGCCTGGGG + Intergenic
999809511 5:155114734-155114756 ACCCACTCTGGAGGTGCTTGAGG + Intergenic
1000084689 5:157879208-157879230 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1000212301 5:159119060-159119082 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1000547543 5:162621730-162621752 GCCCATTCTGGCCATGCTTGAGG + Intergenic
1000889366 5:166784919-166784941 ACCCACTCCGGCCGTGCCTGAGG - Intergenic
1000891888 5:166810669-166810691 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1000902551 5:166927420-166927442 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1001636372 5:173213332-173213354 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1001841473 5:174880550-174880572 GCCCATTCTGGCTGTACTTGAGG + Intergenic
1001843495 5:174901408-174901430 GCCCACTCTGGCCGCACTTGAGG + Intergenic
1002419428 5:179137929-179137951 GCCCCCGTTGGCCGGGCTGGAGG + Exonic
1002567832 5:180121819-180121841 GCCTCCTCTGGAGATGCTTGCGG - Intronic
1002612719 5:180432050-180432072 GTCCACTCGGGCCGTGCTTGAGG + Intergenic
1002616374 5:180459061-180459083 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
1002790796 6:436013-436035 GGCCACTCTGGCTGTGCTTGAGG - Intergenic
1002793137 6:449873-449895 GCCCATTCTGGCCACGCTTGAGG + Intergenic
1002817640 6:694514-694536 ACCCACTCTGGCTGTGCTTGAGG + Intergenic
1002915350 6:1524187-1524209 GCCCCCTCGGCCCGCGGTTGCGG - Intergenic
1003111206 6:3253464-3253486 GTCCTCTCTCGCCGCGCTTGAGG + Intronic
1003176799 6:3758050-3758072 GCCCATTATGGCCGCGCTTGGGG + Intergenic
1003177211 6:3761276-3761298 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1003224540 6:4191762-4191784 GCCCATTCTGACCGCGCTTGAGG - Intergenic
1003489290 6:6606899-6606921 GCCCACTCTGTCCACGCTTGAGG - Intronic
1003490098 6:6613721-6613743 GCCCACTCTGGCCGCGCTTGAGG - Intronic
1003506744 6:6746147-6746169 GCCCACTCTGGCAGAGCTTGAGG - Intergenic
1003531305 6:6939978-6940000 GCCCACTCTGGCCGCGCTTAAGG + Intergenic
1003591555 6:7441162-7441184 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1003593647 6:7456249-7456271 GCCCATTCTGGCCGTGCTTGAGG + Intergenic
1003683935 6:8282417-8282439 GTCCTCTCTGGCCGCGCTCGAGG + Intergenic
1003749510 6:9040651-9040673 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1003824843 6:9942062-9942084 GTCCACTCTGGCCATGCTTGGGG + Intronic
1003836284 6:10075151-10075173 GCCCACTCTGGCCGCGCTTGAGG - Intronic
1003882536 6:10491528-10491550 GCCTACTCTGGCCGTGCTTGAGG + Intergenic
1004045423 6:12018360-12018382 GCCCACTCTGGCCGCGCTTGAGG - Intronic
1004217518 6:13716638-13716660 ACCCACACTGGCCGCGCTTGAGG + Intergenic
1004220545 6:13743091-13743113 GCCCATTCTGGCCGCGCTTCAGG + Intergenic
1004248392 6:14002313-14002335 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1004250244 6:14017922-14017944 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1004338277 6:14784027-14784049 GCCTACTCTGGCCGCGCTTGAGG - Intergenic
1004499745 6:16198563-16198585 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1004587497 6:17016246-17016268 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1004663243 6:17728646-17728668 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1004693361 6:18011658-18011680 ACCCACTCTGGCCGCGTTTGAGG - Intergenic
1004883638 6:20032233-20032255 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1004905374 6:20233105-20233127 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
1005042331 6:21610334-21610356 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1005554310 6:26957063-26957085 GCCCACTCTGGCCGCGCTTCAGG - Intergenic
1005561373 6:27045173-27045195 GCCCACCCTGGCTGGGCTTGAGG + Intergenic
1005749129 6:28866914-28866936 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1005766253 6:29015011-29015033 GCCCACTCTGGCCGCGCTCGAGG + Intergenic
1006083791 6:31582182-31582204 GCTCCCTCTGGTTGTGCCTGTGG - Intronic
1006127895 6:31851945-31851967 GCCCATTCTGGCCGCGCTTGAGG + Intergenic
1006189907 6:32201352-32201374 GCCCTCCCTGGCCCTGCTGGTGG - Exonic
1007532326 6:42554115-42554137 GTCCGCTCTGGCCGCGCTCGAGG + Intergenic
1007814980 6:44515449-44515471 GCTACCTCTGGCCCTGCTTAAGG + Intergenic
1008567769 6:52786401-52786423 GCCCACTCTGGCCACGCTTCAGG + Intergenic
1008587544 6:52962911-52962933 GCACACTCTGGCCATGCTTGAGG - Intergenic
1008745788 6:54667971-54667993 GGGACCTCTGGCCTTGCTTGGGG - Intergenic
1009615555 6:65999835-65999857 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1009664384 6:66655835-66655857 GCCCACTCTGGCTGCACTTGAGG - Intergenic
1009667703 6:66705029-66705051 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1009739219 6:67722940-67722962 GGCCACTCTGGCCGCACTTGAGG + Intergenic
1009746621 6:67825289-67825311 ACCCAATCTGGCAGTGCTTGAGG + Intergenic
1009800657 6:68533321-68533343 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1009872202 6:69467089-69467111 GTCCACTCTGGCCATGCTCGGGG + Intergenic
1009873111 6:69472969-69472991 GTCCACTCTGGCCATGCTTGGGG + Intergenic
1010269284 6:73903047-73903069 GTCCACTCTGGCCATGCCTGAGG + Intergenic
1010270310 6:73909875-73909897 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
1011178064 6:84587319-84587341 GCCCGCTCTGGCCAGGCTTGAGG + Intergenic
1011879998 6:92012216-92012238 GCCCACTGTGGCCACGCTTGAGG - Intergenic
1012144958 6:95669927-95669949 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
1012598796 6:101070150-101070172 GCCCACTCTAGCCGTGCTTGAGG + Intergenic
1012733602 6:102911113-102911135 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1012850925 6:104446223-104446245 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1013853403 6:114542156-114542178 GCCCATTCTGGCCGCACTTGAGG - Intergenic
1013963515 6:115928512-115928534 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1014088438 6:117373759-117373781 GTCTGCTCTGGCCATGCTTGAGG - Intronic
1014280740 6:119440887-119440909 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1014299630 6:119665567-119665589 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
1014586243 6:123201845-123201867 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1016814134 6:148288064-148288086 GCCCTAACTGGCCGTGCTTGTGG + Intronic
1016859125 6:148699054-148699076 GCCCGCTCTGGCTGCACTTGAGG - Intergenic
1017017847 6:150116105-150116127 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1018551395 6:165002048-165002070 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1020163870 7:5793468-5793490 GCCCACTCTGGCTGCGCTTGAGG + Intergenic
1020375420 7:7479014-7479036 GCCCACTCTGGCCATGCTTGAGG - Intronic
1020662264 7:10995999-10996021 GCCCACTCTGGCCGCACTTGAGG - Intronic
1020784510 7:12556631-12556653 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1021133810 7:16942876-16942898 GCCCATTCTGGCCATGCTTGAGG + Intergenic
1021359471 7:19692707-19692729 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1021513882 7:21461718-21461740 GCCCATTCTGGCTGCGCTTGAGG - Intronic
1021520762 7:21537008-21537030 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1021573807 7:22090219-22090241 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1021761353 7:23905186-23905208 ACCCATTCTGGCCGTGCTTGAGG - Intergenic
1022519100 7:30994475-30994497 ATCCGCTCTGGCCGTGCTGGAGG - Intergenic
1023232441 7:38049663-38049685 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1023377931 7:39577330-39577352 ACCCACTCTGGCTGCGCTTGAGG + Intronic
1024735892 7:52303390-52303412 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1024748265 7:52431712-52431734 GCCCACTCTGGCCACTCTTGAGG - Intergenic
1024794277 7:53003829-53003851 GCCCATTCTAGCTGTGCTTGAGG + Intergenic
1026098404 7:67364984-67365006 GTCCGCTCTGGCCACGCTTGAGG - Intergenic
1026237063 7:68535574-68535596 GCCCATTCTGGCCATGCTTGAGG - Intergenic
1026516497 7:71077877-71077899 GCCCATTCTGGCTGCGCTTGAGG + Intergenic
1027668683 7:81070995-81071017 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1027955975 7:84880456-84880478 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1028392591 7:90334308-90334330 ACCCACTCTGGCCGTGCTTGAGG + Intergenic
1028719491 7:94012340-94012362 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1028912924 7:96228597-96228619 GCCCACTCTGGCCACACTTGAGG + Intronic
1028989428 7:97034227-97034249 GCCCATTCTGGCCGCGCTTGAGG + Intergenic
1029037867 7:97541142-97541164 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1029065408 7:97843338-97843360 ATCCACTCTGGCCGCGCTTGAGG - Intergenic
1029596302 7:101539117-101539139 GCCCCATCTGTCCCTCCTTGAGG - Intronic
1030102183 7:105956230-105956252 GCCCACTCTGGCGGCACTTGAGG - Intronic
1030292626 7:107887874-107887896 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1030772281 7:113488599-113488621 GCCCACTCTGGCCTCACTTGAGG - Intergenic
1030980749 7:116182394-116182416 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1031056606 7:116998471-116998493 GCCCACTCTGGCCGCGCTTGAGG - Intronic
1031109899 7:117596035-117596057 GCCCACTCTGGCTGTGCGTGAGG + Intronic
1031213411 7:118859121-118859143 GTCCACTCTGGCAGTGCTTGAGG - Intergenic
1031605590 7:123763644-123763666 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1031730937 7:125299625-125299647 ATCCGCTCTGGCCGCGCTTGAGG - Intergenic
1031846089 7:126806974-126806996 GTCCGCTCTGGCCGCGCTCGAGG - Intronic
1031934836 7:127725826-127725848 GCCCCATCTGCCTGTCCTTGAGG - Intronic
1032339578 7:131058650-131058672 GCCCACTCTGGCCACACTTGCGG + Intergenic
1032437052 7:131909224-131909246 GTCCACTCTGGCGGCGCTTGAGG + Intergenic
1032804528 7:135341142-135341164 GCCCACTCTGGCCGTCCTCTGGG - Intergenic
1033758663 7:144418371-144418393 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1033779257 7:144650307-144650329 GCCCACTCTGGCTGCACTTGAGG + Intronic
1033866712 7:145697842-145697864 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1034100421 7:148445698-148445720 GTCCGCTCTGGCCACGCTTGAGG - Intergenic
1035325350 7:158062458-158062480 GCCCACTCTGGCCCTGCTTGAGG + Intronic
1035463968 7:159063604-159063626 GCCCACTCTGGCCGCGCTTGAGG - Intronic
1035683638 8:1507585-1507607 GCCCACTCCGGCCGCACTTGAGG - Intronic
1036134991 8:6152594-6152616 GCCCACCCTGGCCGTGCTTGAGG + Intergenic
1036801300 8:11794692-11794714 GCCCATTCTGGCCGCGCTTGAGG + Intergenic
1036928723 8:12931775-12931797 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1037064942 8:14566709-14566731 GCCCACTCTGGCCGTACTTGAGG + Intronic
1037239572 8:16760979-16761001 GCCCACTCTGGCGGCGCTTGAGG - Intergenic
1037417645 8:18668157-18668179 GCCCACTCTGGCCGCGCTTGAGG - Intronic
1037558890 8:20054678-20054700 GCCCATTCTGGCCATGCTTGAGG + Intergenic
1038726636 8:30088029-30088051 GTCCGCTCTGGCCGCGCTGGAGG + Intergenic
1038847671 8:31244579-31244601 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1039068667 8:33631565-33631587 GCCCATTCTGGCCATGTTTGAGG + Intergenic
1040000804 8:42575102-42575124 ACCCACTCTGGCTGTGCTTGAGG + Intergenic
1040003763 8:42600530-42600552 ACCCACTCTGGCCGCGCTTGAGG - Intergenic
1040026482 8:42786662-42786684 ACCCACTCTGGCTGGGCTTGAGG + Intronic
1040027508 8:42795539-42795561 GCCTGCTCTGGCCATGCTTGAGG + Intronic
1040583483 8:48716459-48716481 GTCCACTCTGTCCGCGCTTGAGG - Intronic
1040622310 8:49103492-49103514 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1040701716 8:50074745-50074767 GCCCACTCTGGCCGCACTTGAGG + Intronic
1040804277 8:51377404-51377426 GGCCACTCTGGCCGTGCTTGAGG + Intronic
1040952821 8:52953700-52953722 GCCCACTCTGGCCCAGCTTGAGG + Intergenic
1040953948 8:52961281-52961303 GCCCACTCTGGCCACACTTGAGG + Intergenic
1040965637 8:53078101-53078123 ATCCACTCTGGCCATGCTTGAGG - Intergenic
1041588306 8:59547008-59547030 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1041604413 8:59762428-59762450 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1041623487 8:59999743-59999765 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
1041636745 8:60153429-60153451 GCCCACTCTTGCCATGCTTGAGG - Intergenic
1042335964 8:67630611-67630633 GCCCACTCTGGCCATGCTTGGGG + Intronic
1042948822 8:74179990-74180012 GCCCACTCTGGCTGCACTTGAGG - Intergenic
1043621100 8:82192723-82192745 GTCCACTCTTGCCGTGCTTGAGG - Intergenic
1043640096 8:82441309-82441331 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1043670573 8:82880576-82880598 ACCCACTCTGGCTGAGCTTGAGG + Intergenic
1043726046 8:83611581-83611603 GTCCACTCTGGCCACGCTTGAGG - Intergenic
1043732005 8:83694429-83694451 ACCCACTCTGGCTGCGCTTGAGG - Intergenic
1044441576 8:92230676-92230698 GCCCATTCTGGCTGTGCTTGAGG + Intergenic
1044456060 8:92394023-92394045 GTCCTCTCTGGCCGCACTTGAGG - Intergenic
1044459715 8:92429703-92429725 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1044853504 8:96452207-96452229 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1044963851 8:97556801-97556823 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
1045096152 8:98800474-98800496 GTCCACTCTGGCCACGCTTGAGG + Intronic
1045306091 8:100957581-100957603 GCCCACTCTGGCTGCGCTTGAGG - Intergenic
1045678479 8:104633358-104633380 GTCTACTCTGGCCATGCTTGAGG - Intronic
1046251819 8:111642738-111642760 GTCCACTCCGGCGGTGCTTGAGG + Intergenic
1046260382 8:111759229-111759251 GTCCGCTCTGGCCATGCTTGAGG - Intergenic
1046497700 8:115036595-115036617 GTCCACTCTGGCCATGCTTGAGG + Intergenic
1046521461 8:115331037-115331059 GTCCACTCTGGCCGTGCTTGAGG - Intergenic
1047100247 8:121667886-121667908 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1047124663 8:121947923-121947945 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1047295668 8:123568617-123568639 GCCCCTTCTGGCAGCGCTAGGGG + Intergenic
1047631779 8:126715109-126715131 GCCCACACTGGCCGCGCTTGAGG - Intergenic
1047966964 8:130052021-130052043 GCTTCCTCTGGCTGTGCTTTCGG - Intergenic
1048112791 8:131486932-131486954 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1048186948 8:132250130-132250152 GTCCGCTCTGACCATGCTTGAGG - Intronic
1048677033 8:136794263-136794285 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1048703082 8:137116038-137116060 GTCCACTCTGGCGGTGCTGGAGG - Intergenic
1048738401 8:137527349-137527371 GCCCCCTCTGCCTTTCCTTGTGG - Intergenic
1049157641 8:141076574-141076596 GCTCACTCTGGCCGCGCTTGAGG + Intergenic
1049217092 8:141413198-141413220 GCCTCCTCTGGGCCTGCTGGGGG + Intronic
1049755158 8:144308177-144308199 CCCCTCTCTGGCCCTGCTTCAGG + Intronic
1049857875 8:144875057-144875079 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
1049944584 9:581248-581270 GCCCCCTCTGGCCGTGCTTGAGG - Intronic
1050249885 9:3733699-3733721 GCCCACTCTGGCCCCGCTCGAGG + Intergenic
1050377203 9:4985384-4985406 GGCCCCTCGGCCCGGGCTTGCGG + Exonic
1050891941 9:10835854-10835876 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1050975315 9:11929328-11929350 ACCCACTCTGGCCGCGCTTGAGG - Intergenic
1051314257 9:15810876-15810898 GTCTGCTCTGGCCATGCTTGAGG - Intronic
1051404362 9:16719217-16719239 GCGCCCTCTGCCAGTGCTGGAGG - Intronic
1051419776 9:16877527-16877549 GCCCACTCTGGCTGTGCTTGAGG - Intergenic
1051449470 9:17178857-17178879 GCCCACTCTGGCCACGCTTCAGG - Intronic
1051549837 9:18315803-18315825 GTCCACTCTGGCTGTGCTTGAGG - Intergenic
1052014780 9:23451922-23451944 GCCCACTCTGGCGGCACTTGAGG + Intergenic
1052576503 9:30299154-30299176 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1053393325 9:37751764-37751786 GCCCGCTCTGGCCACGCTTGAGG + Intronic
1053475172 9:38377463-38377485 GCCCACTCTGGCCGCCCTTGAGG + Intergenic
1053678230 9:40460922-40460944 GTCCACCCTGGCCGCGCTTGAGG + Intergenic
1054285494 9:63164024-63164046 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1054291308 9:63296459-63296481 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1054389328 9:64600999-64601021 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
1054506389 9:65915373-65915395 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1055187529 9:73474371-73474393 GCCCCATCTGGCCAGGCTTGTGG - Intergenic
1055248668 9:74276404-74276426 GCCCACTCTGGCCACACTTGAGG - Intergenic
1055654859 9:78441956-78441978 GTCCGCTCTGGCCATGCTCGAGG + Intergenic
1055814241 9:80185769-80185791 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1055985571 9:82054805-82054827 GCCCACTCTGGCCACACTTGAGG - Intergenic
1056216204 9:84408366-84408388 GCCCACTCTGGCGGCGCTTGAGG + Intergenic
1056305691 9:85288934-85288956 GCCCACTCTCGCCAAGCTTGAGG + Intergenic
1056330701 9:85518906-85518928 GCCCCCTGTGGCCTTCCTTTTGG - Intergenic
1056735869 9:89209290-89209312 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1056799369 9:89680983-89681005 GCCCACTCTGGCCGCACTTGAGG + Intergenic
1057118093 9:92545132-92545154 GCCCACTCTGGCCGTGCTTGAGG + Intronic
1057300635 9:93879828-93879850 GCCCACTCCGGCCATGCTTGAGG + Intergenic
1057490639 9:95517044-95517066 GCCCCCCGCGGCCGTGTTTGCGG + Intronic
1057689599 9:97271576-97271598 GTCTGCTCTGGCCGTGCTCGAGG - Intergenic
1057725534 9:97565437-97565459 GCCCTCTCTGGCCCTGTTTCTGG - Intronic
1057726845 9:97574105-97574127 GCCCACTCTGGCCGCGCTTGTGG + Intronic
1058065180 9:100540600-100540622 ATCCGCTCTGGCCCTGCTTGAGG - Intronic
1058309445 9:103483600-103483622 GCCCACTCTGGCCGTAATTGAGG + Intergenic
1058379634 9:104363374-104363396 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1058637192 9:107048313-107048335 GCCCCCTCAGGAAGTGCTTTGGG - Intergenic
1059891514 9:118809689-118809711 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1060734141 9:126055603-126055625 GGCCCCTCTGGAGGTGCCTGCGG + Intergenic
1061822710 9:133237385-133237407 TCCCCCTCTGGCAGTGCTGGGGG - Intergenic
1062236585 9:135513067-135513089 TCCCCGTCTGGCAGTGCTGGGGG + Intergenic
1203460490 Un_GL000220v1:31442-31464 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1203662321 Un_KI270753v1:57234-57256 GCCCACTCTGGCCGCATTTGAGG + Intergenic
1203662941 Un_KI270753v1:61844-61866 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1203670430 Un_KI270755v1:6853-6875 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1186293118 X:8121475-8121497 GCCCACTCTGGCCGCACCTGAGG + Intergenic
1186456964 X:9717355-9717377 GCTCCCTCAGGCCCTGCCTGTGG - Exonic
1186460377 X:9743759-9743781 TGCCCCTCTGGCCTTGCTTGTGG - Intronic
1188078298 X:25806057-25806079 GTCCACTCTGGCTGTGCTCGAGG - Intergenic
1188451102 X:30308855-30308877 GCGCCCCCTGGCCGTGCCTCGGG + Exonic
1189467189 X:41286182-41286204 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1190266706 X:48831331-48831353 GCCCCCTGAGGGCGTGCTGGGGG - Exonic
1191053977 X:56223026-56223048 GCCCACTCTGGCCGCACTTGAGG - Intergenic
1191105016 X:56767378-56767400 GTCCACTCTGGCCGCCCTTGAGG + Intergenic
1192022402 X:67408547-67408569 GCCCACTCTGGCTGTGCTTGAGG + Intergenic
1192251330 X:69416677-69416699 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1194025654 X:88746800-88746822 GGCCACTCTGGCCGCGCTTGAGG - Intergenic
1194340516 X:92699949-92699971 ATCCACTCTGGCCATGCTTGAGG - Intergenic
1194384304 X:93235617-93235639 GCCCACTCTGGCCACGCTTGAGG + Intergenic
1195460326 X:105116182-105116204 GCCCACTCTGGCCGCGCTTGAGG - Intronic
1195909672 X:109876332-109876354 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1196616076 X:117768954-117768976 ACCCACTCTGGCCGCGCTTGAGG + Intergenic
1196860934 X:120026260-120026282 GCCCACTCTGGCCACGCTTGAGG - Intergenic
1197079027 X:122389333-122389355 GTCCACTCTGGCCATGCTGGAGG - Intergenic
1197117706 X:122852471-122852493 GCCCTGTCTTGCTGTGCTTGAGG - Intergenic
1197533846 X:127663444-127663466 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1197607841 X:128606491-128606513 GCCCACTCTGGCCGCGCTTGAGG + Intergenic
1197774715 X:130111349-130111371 GCCCCCTCGGCCCGTGCAAGTGG + Intergenic
1197978686 X:132193981-132194003 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1198060843 X:133044263-133044285 GCCCACTCTGGCCGCGCTTGAGG + Intronic
1199094911 X:143726691-143726713 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1199097249 X:143757679-143757701 GTCCGCTCTGGCCGCGCTGGAGG - Intergenic
1199437513 X:147828953-147828975 GTCTGCTCTGGCCGTGCTTGAGG - Intergenic
1199831852 X:151555625-151555647 GCCCATTCTGGCCGCACTTGAGG - Intergenic
1199833097 X:151563254-151563276 GCCCACTCTGGCCGCGCTTGAGG - Intergenic
1200383483 X:155865261-155865283 GTCCGCTCTGGCCAGGCTTGAGG + Intergenic
1200829023 Y:7673016-7673038 GCCCACTCTGGCGGCGCTTGAGG + Intergenic
1200873697 Y:8128990-8129012 GTCCGCTCTGGCCATGCTCGGGG - Intergenic
1201232694 Y:11880010-11880032 ATCCACTCTGGCTGTGCTTGAGG - Intergenic
1201429119 Y:13887747-13887769 GCCCACTCTGGCCATGCTTAAGG + Intergenic
1201430459 Y:13897124-13897146 GCCCACTCTGGCTGTGCTTAAGG + Intergenic
1201555228 Y:15260050-15260072 GCCCACTCTGGCCATACTTGAGG + Intergenic
1201556265 Y:15267185-15267207 ACTCACTCTGGCCATGCTTGAGG + Intergenic
1202013819 Y:20379059-20379081 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1202100653 Y:21304042-21304064 GTCCACTCTGGCCACGCTTGAGG - Intergenic
1202271563 Y:23078814-23078836 GCCCATTCTGGCCATGCTTGAGG - Intergenic
1202294463 Y:23341868-23341890 GCCCATTCTGGCCATGCTTGAGG + Intergenic
1202368980 Y:24184791-24184813 GACCCCTCTGGAGGTACTTGAGG + Intergenic
1202424558 Y:24712558-24712580 GCCCATTCTGGCCATGCTTGAGG - Intergenic
1202446231 Y:24957527-24957549 GCCCATTCTGGCCATGCTTGAGG + Intergenic
1202501805 Y:25485326-25485348 GACCCCTCTGGAGGTACTTGAGG - Intergenic