ID: 1049948057

View in Genome Browser
Species Human (GRCh38)
Location 9:617344-617366
Sequence TAGGAGAAGGATTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049948047_1049948057 18 Left 1049948047 9:617303-617325 CCAGACATGTCTTTTGTCTTCAA 0: 1
1: 0
2: 3
3: 20
4: 274
Right 1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049948057 Original CRISPR TAGGAGAAGGATTGGGGAGG AGG Intronic
No off target data available for this crispr