ID: 1049949169

View in Genome Browser
Species Human (GRCh38)
Location 9:627699-627721
Sequence CAGGGGGACCAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049949160_1049949169 11 Left 1049949160 9:627665-627687 CCAGCTCGTATCTTGGTTTTGCA 0: 1
1: 0
2: 2
3: 9
4: 125
Right 1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049949169 Original CRISPR CAGGGGGACCAGAGGGTGGA TGG Intronic
No off target data available for this crispr