ID: 1049949171

View in Genome Browser
Species Human (GRCh38)
Location 9:627707-627729
Sequence GCACTCTCCCATCCACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049949171_1049949174 26 Left 1049949171 9:627707-627729 CCAGAGGGTGGATGGGAGAGTGC 0: 1
1: 0
2: 3
3: 31
4: 237
Right 1049949174 9:627756-627778 TATATCCTGTCTTGGATTGGTGG No data
1049949171_1049949173 23 Left 1049949171 9:627707-627729 CCAGAGGGTGGATGGGAGAGTGC 0: 1
1: 0
2: 3
3: 31
4: 237
Right 1049949173 9:627753-627775 AAGTATATCCTGTCTTGGATTGG No data
1049949171_1049949172 18 Left 1049949171 9:627707-627729 CCAGAGGGTGGATGGGAGAGTGC 0: 1
1: 0
2: 3
3: 31
4: 237
Right 1049949172 9:627748-627770 AGCACAAGTATATCCTGTCTTGG No data
1049949171_1049949175 27 Left 1049949171 9:627707-627729 CCAGAGGGTGGATGGGAGAGTGC 0: 1
1: 0
2: 3
3: 31
4: 237
Right 1049949175 9:627757-627779 ATATCCTGTCTTGGATTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049949171 Original CRISPR GCACTCTCCCATCCACCCTC TGG (reversed) Intronic
900350854 1:2233907-2233929 GTGCTCTCCCAGACACCCTCAGG + Intronic
900355222 1:2258354-2258376 CCACTGTCCCATCCTCCCTAGGG - Intronic
900399014 1:2465363-2465385 GCCCTCTGCCCTCCACCCTCCGG + Intronic
900432049 1:2607089-2607111 TCACTCTCCCAGCCTCCCTGTGG + Intronic
900842500 1:5065759-5065781 ACACTCCCCCATCTACCCACAGG - Intergenic
900884962 1:5408603-5408625 GCTCTGTCCCATCCAGCCGCTGG - Intergenic
901021206 1:6256927-6256949 GCACTCTCCTCTCCACGCCCCGG + Intronic
901854878 1:12038272-12038294 GCTCCCTACCATCCACCCTAGGG - Intergenic
902141846 1:14363372-14363394 GCTCACACCCACCCACCCTCTGG + Intergenic
904274686 1:29372793-29372815 CCCCTCTCCTTTCCACCCTCTGG + Intergenic
904700649 1:32355940-32355962 GCCCTCTCCCACCCACCATTAGG - Intronic
906102889 1:43274334-43274356 GTAGCCTCCCAACCACCCTCAGG - Intergenic
909608680 1:77531768-77531790 GCCCAGTCCCATCCACCCTGAGG - Intronic
912079284 1:105914495-105914517 GCACTGTCACATGCACCCTGGGG + Intergenic
912480020 1:109976153-109976175 GAACTCTTCCCTCCACCCTGGGG + Intergenic
916059437 1:161088727-161088749 GAAATCCCCCATCCACTCTCTGG + Intronic
916541143 1:165755738-165755760 TCCCTTTCCCATCCACCTTCTGG + Intronic
917732664 1:177891739-177891761 GCCCTCTCCACTCCACCCCCAGG + Intergenic
919105148 1:193140385-193140407 GTAGTCCCCCATCCACCCTCTGG + Intronic
919371632 1:196734654-196734676 CCACTCTCCCTTCCCCCCACAGG - Intronic
919799399 1:201344388-201344410 GCACTCACACAGCAACCCTCCGG + Intergenic
920527206 1:206675843-206675865 CCACTCTCCCTTCCACCATGAGG - Intronic
922241152 1:223756213-223756235 GCAGTCTCCTCTCCGCCCTCAGG + Intronic
1067238665 10:44472393-44472415 GCCCTCTCCCATGTATCCTCAGG + Intergenic
1067499269 10:46787023-46787045 TCACTCTCCCAACGACCCTCGGG - Intergenic
1067595360 10:47553301-47553323 TCACTCTCCCAACGACCCCCGGG + Intergenic
1067721993 10:48734848-48734870 TCACTGTACCCTCCACCCTCAGG + Intronic
1069044065 10:63723982-63724004 GGGCGCTCCCATGCACCCTCGGG + Intergenic
1069687195 10:70325737-70325759 GCACCCACGCAACCACCCTCAGG - Intronic
1070501697 10:77078741-77078763 GCACTCTCCCTGACACCCACAGG - Intronic
1070777046 10:79115802-79115824 GCCCTCCCCCATCCAACCTCAGG - Intronic
1072223067 10:93344015-93344037 AAACTCTACCATCCACCCTATGG - Intronic
1075630467 10:123997805-123997827 TCCCTCACCCCTCCACCCTCAGG + Intergenic
1075715251 10:124551760-124551782 GCACCCTCCCCTCCACCTGCCGG + Intronic
1076731190 10:132439932-132439954 GCACACACACATCCACCCACAGG - Intergenic
1077166233 11:1140671-1140693 GCCCTCTCCTCTCCACCTTCCGG - Intergenic
1077229142 11:1450816-1450838 GCTCTCTCCCAGCCCCACTCTGG - Intronic
1077456736 11:2685929-2685951 CCACTCTCCCATCCTCCTGCTGG + Intronic
1078095374 11:8293165-8293187 TCACTCTCCCTTCTGCCCTCAGG - Intergenic
1079367059 11:19818707-19818729 GCACTTTAGCATCCACCGTCGGG + Intronic
1079743934 11:24101282-24101304 GACCTCTCCACTCCACCCTCAGG + Intergenic
1081446347 11:43134790-43134812 TCACTCTCCCATACAAACTCTGG + Intergenic
1082790404 11:57342881-57342903 GCACCCTCCCATCCGCCCCCAGG - Intronic
1083155755 11:60821958-60821980 GCCCTCCCCCCTCCACCCCCAGG + Intergenic
1083594624 11:63913058-63913080 GCTTTCTGCCATCCACCATCTGG + Intronic
1083899847 11:65638301-65638323 GCACCCTCCCAACTTCCCTCCGG + Intronic
1084164730 11:67370304-67370326 GCCCTCATCCATCCTCCCTCAGG + Intronic
1088425380 11:109696367-109696389 GCCCTCTCCGCTCCACCCTCAGG + Intergenic
1088809909 11:113385254-113385276 GCTCTCTCCCCTCCACACACTGG + Intergenic
1089259609 11:117214969-117214991 CCACTCTCCCTCCTACCCTCAGG + Intronic
1089448467 11:118572644-118572666 GCACTCTGCCCTAGACCCTCAGG - Intronic
1089574901 11:119435159-119435181 TCACCCTCACAGCCACCCTCAGG + Intergenic
1090483228 11:127086397-127086419 GCCCTCTCCAACTCACCCTCAGG + Intergenic
1090621375 11:128564006-128564028 GTACCCTCCCAACCACCCTACGG + Intronic
1090854340 11:130598630-130598652 CCGCTCTCCCGTCCACCCCCGGG - Intergenic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1091109624 11:132953704-132953726 GCATTCTCTCCTCCACACTCTGG - Intronic
1093091233 12:14922992-14923014 GCAACCTCCCCTCCACCTTCTGG - Intronic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1094419725 12:30257828-30257850 CCACTCCCCCCTCCAACCTCAGG + Intergenic
1095800234 12:46264758-46264780 GCATCCTCCCTTCCAACCTCTGG + Intronic
1096482668 12:51952466-51952488 GCAATCCCCCCTCCGCCCTCCGG + Intronic
1098242181 12:68479357-68479379 CCAGTCTGCCCTCCACCCTCGGG - Intergenic
1102642308 12:114377972-114377994 AAACTTTCCCATCCACTCTCTGG + Intronic
1102897643 12:116611379-116611401 CCACCCTCCCATCCACCCCTCGG - Intergenic
1103058636 12:117841330-117841352 GAAGCCTCCCATCCTCCCTCAGG + Intronic
1106452259 13:29893985-29894007 GCACACTCCCACCCATTCTCTGG + Intergenic
1107158544 13:37198197-37198219 GCCCTCTCCACTCCACCCCCAGG - Intergenic
1107896752 13:44972485-44972507 GCAGCCTCCCCTCCACCCACTGG - Intronic
1108249558 13:48551041-48551063 GCACCCCCTCATCCTCCCTCTGG - Intergenic
1111445962 13:88345866-88345888 GCACTGTCCCAGCCCCTCTCTGG - Intergenic
1112128936 13:96499788-96499810 GCACCCTCCCACCCACACTTGGG - Intronic
1113511850 13:110862795-110862817 CCACCATCCCACCCACCCTCAGG + Intergenic
1113594333 13:111520678-111520700 GGACACACCCCTCCACCCTCTGG - Intergenic
1113881397 13:113628749-113628771 GCACTGTCCCATCCACCCTTTGG + Intronic
1115480060 14:33851738-33851760 GTACTCTCCCCTCCACTCCCCGG - Intergenic
1116858834 14:49977701-49977723 CCAATCTCCCATCCAGCATCTGG - Intergenic
1117316489 14:54576090-54576112 GAACTCTCCCATCCAGTCTCTGG - Intronic
1118722073 14:68601444-68601466 GCACTCTCCCAGCCCCCTTTAGG - Intronic
1119329638 14:73784489-73784511 CCACTCTCCCAGCTACACTCTGG + Intronic
1119693182 14:76692609-76692631 GGATTCTCCCTTCCAGCCTCTGG - Intergenic
1120138868 14:80904324-80904346 CCCCTCTCCCCGCCACCCTCTGG - Intronic
1120195229 14:81474866-81474888 GCACTTTCCCATCCAGCCTTAGG + Exonic
1121123381 14:91390533-91390555 GCCCTCACCCCTCCAGCCTCTGG + Intronic
1121273633 14:92653307-92653329 GCACCCTCTCTTCCACCATCAGG + Intronic
1121572973 14:94961601-94961623 ACACTCTCCCATTCCCCCTTAGG + Intergenic
1121796610 14:96741421-96741443 GCACCCTCCCATCAGCCATCCGG + Intergenic
1122068921 14:99192791-99192813 GGACTCTTCCATGCACGCTCTGG - Intronic
1122463806 14:101917092-101917114 GAACCCTCACAGCCACCCTCCGG + Intronic
1123034109 14:105464896-105464918 GCTCTCTCCCCACCACCCGCAGG - Intronic
1128092540 15:64928754-64928776 GCCCTCTCCCCTCCACCTTGGGG - Intronic
1128376196 15:67077813-67077835 CCACTCCCTCATCCACACTCTGG - Intronic
1128695258 15:69757230-69757252 ACACTCTCCCATCCACTTTACGG - Intergenic
1129410721 15:75348883-75348905 GGACTCTGCCACCCTCCCTCAGG + Exonic
1129570283 15:76675781-76675803 GCACTCTTCAATCTATCCTCAGG + Intronic
1131669356 15:94602848-94602870 GCACTCTCCAATCCCCGCTTTGG - Intergenic
1132629914 16:912182-912204 GCACTCTCCCATCCGCTCTGTGG - Intronic
1132629924 16:912248-912270 GCACTCTCCCATCTGCTCTGTGG - Intronic
1132629940 16:912314-912336 GCACTCTCCCGTCCTCTCTGTGG - Intronic
1133155153 16:3869106-3869128 GCCATCTCCTATTCACCCTCAGG + Intronic
1133403952 16:5508510-5508532 GCAATCTCCCACCCGACCTCGGG - Intergenic
1134753330 16:16644506-16644528 TCACTCACCCCCCCACCCTCTGG + Intergenic
1134992727 16:18714577-18714599 TCACTCACCCCCCCACCCTCTGG - Intergenic
1135640956 16:24119447-24119469 GAACTTTCCCATCCACCTGCGGG - Intronic
1139260610 16:65589881-65589903 GCCCCCTCCCTTCCACCCCCAGG - Intergenic
1139267863 16:65656669-65656691 GCAGCCTCCCAGCCACCCTGTGG - Intergenic
1140999750 16:80297329-80297351 GCAGTGTCACTTCCACCCTCAGG + Intergenic
1142032257 16:87844444-87844466 GGAGTCTCCCCTCCAGCCTCGGG - Intronic
1142274857 16:89113011-89113033 GCACTCTCCCATGAACCTGCAGG + Intronic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1142867077 17:2797632-2797654 GCACTTTGCCATCCATCCTCTGG + Intronic
1143172452 17:4938113-4938135 GCACCCTCCCACCCACCTCCAGG + Intronic
1144080623 17:11760827-11760849 TCACTCTCACAGCCACCCTGCGG + Intronic
1144993349 17:19249293-19249315 TCTCCCTCCCAGCCACCCTCAGG - Intronic
1147989146 17:44322771-44322793 GCACCCTCCCATGCTCCCTGTGG + Intronic
1148132420 17:45270255-45270277 GCAATCTCCCAACAACCCTGAGG + Intronic
1151858409 17:76738878-76738900 GCAGTCTCCCTCCCACCCTTGGG - Intronic
1151967423 17:77438654-77438676 GCAGTCTCCCCTGCAGCCTCGGG + Intronic
1152738322 17:82008217-82008239 GCAGTCTCCCACCCAGCCACGGG - Intronic
1156520558 18:37719361-37719383 GCACACTCACATCCATCTTCCGG + Intergenic
1157907291 18:51580781-51580803 GCGCTCTCTCCTCCACACTCTGG - Intergenic
1158079222 18:53568577-53568599 CCACTCTCAGATCCACCCTTTGG - Intergenic
1161482946 19:4519754-4519776 GAGCTCTCCCAGCCACCCTTGGG - Intergenic
1162577539 19:11507626-11507648 AGCCTCTCCCATGCACCCTCAGG + Intronic
1162726096 19:12690382-12690404 TCAGTCTTGCATCCACCCTCAGG + Intronic
1163497919 19:17657343-17657365 GCAAACTCCTACCCACCCTCTGG + Intronic
1163600879 19:18248350-18248372 ACACTCTGCCCTCCACCCACTGG - Intronic
1163987263 19:20965140-20965162 GCACTTTGCCATCCATTCTCTGG - Intergenic
1164460415 19:28442945-28442967 GCACTCACCCCTCCACACTGTGG - Intergenic
1166930940 19:46301009-46301031 GCCCTCTCGCCCCCACCCTCTGG + Intronic
1167473796 19:49689101-49689123 GCACCCACCCTTCCACCCTCAGG + Exonic
1168579950 19:57547058-57547080 GCACTCTGTCATCCACACTGGGG - Exonic
927855984 2:26528249-26528271 ACCCTCTCCCAACCCCCCTCAGG - Intronic
927890313 2:26743967-26743989 GCTCCCTCCCATCCATGCTCTGG + Intergenic
930001317 2:46863550-46863572 GCCTTCTCCCAGCCAGCCTCGGG - Intergenic
932302073 2:70674619-70674641 GAGCTCTCCCCTCCACCCTGGGG + Intronic
932421380 2:71603418-71603440 GGTCTCTGCCACCCACCCTCTGG - Intronic
933336733 2:80968005-80968027 GCACTCTCCACTCCACAGTCAGG + Intergenic
938243989 2:129763523-129763545 GCACACTCCATGCCACCCTCTGG + Intergenic
938294809 2:130171612-130171634 CCTTTCTCCCCTCCACCCTCTGG + Intronic
938461822 2:131502232-131502254 CCTTTCTCCCCTCCACCCTCTGG - Intergenic
940255571 2:151724660-151724682 GGACTCTTCCATCCACCCATAGG + Intronic
942045400 2:172096673-172096695 GCCCTCTCCGCTCCACCCTCTGG - Intergenic
942741283 2:179181440-179181462 ACAGTCTCTGATCCACCCTCAGG + Intronic
943912283 2:193584182-193584204 GCCCTCTTCCATCCACACTCAGG + Intergenic
944014722 2:195021674-195021696 TCACTGTCCCTTCCACCCTTAGG + Intergenic
945053255 2:205846032-205846054 GGACTGTCCTACCCACCCTCTGG + Intergenic
945494972 2:210499012-210499034 GCCCTCTCTGCTCCACCCTCTGG - Intronic
947675783 2:231978640-231978662 GCACTCCACCATCCTCACTCTGG + Intronic
947992410 2:234497477-234497499 GCGCTCTCCCAGTCACCCTGGGG - Intergenic
948371788 2:237494265-237494287 GCCCTCTGCCCTCCACTCTCTGG - Intronic
948479043 2:238239257-238239279 GCTCTCTCCCTCCCACCCTCGGG - Intronic
948884032 2:240874183-240874205 GCGCTCTCCCGCCCACCCTCTGG + Intronic
1169334939 20:4748423-4748445 GCACTGTGCCACCCACCCTGGGG + Intergenic
1170832769 20:19857654-19857676 AGACACTCCCATGCACCCTCTGG - Intergenic
1171089957 20:22275690-22275712 CCACTTTCCCATCCCCGCTCAGG - Intergenic
1171519693 20:25766283-25766305 GCACTCACCCCTTCACCCTGGGG - Intronic
1171537408 20:25907492-25907514 GCACTCACTCATCCTCCCTCAGG - Intergenic
1171557227 20:26090210-26090232 GCACTCACCCCTTCACCCTGGGG + Intergenic
1171840361 20:30202831-30202853 GCACTCACTCATCCTCCCTCAGG - Intergenic
1172046566 20:32084573-32084595 TCCCTCTCCCCTCCACCCTCTGG - Intronic
1172613657 20:36269172-36269194 GCTCTCTGCCATTCATCCTCTGG - Intronic
1173816915 20:45995430-45995452 GCACCCACCCACCCACGCTCCGG - Intergenic
1175874713 20:62223911-62223933 GCACCCTCCCAAGCATCCTCAGG + Intergenic
1175876057 20:62230739-62230761 GCACTCTCCCCTGCTCCCCCAGG - Intergenic
1176387523 21:6146195-6146217 GCTCGCTCCCCTCCACCCTCTGG + Intergenic
1178705466 21:34869174-34869196 GCTCTCTCCCCTCCTCCCTCAGG + Intronic
1178881010 21:36450102-36450124 GCCCTTTCCCCTCCACCCTCAGG + Intergenic
1179041921 21:37811020-37811042 GCCCTAACCCATCCATCCTCCGG + Intronic
1179735949 21:43392053-43392075 GCTCGCTCCCCTCCACCCTCTGG - Intergenic
1180032249 21:45220460-45220482 GCTCCCACCCATCCACTCTCAGG + Intronic
1180708028 22:17821585-17821607 CTACCCTCCCCTCCACCCTCTGG - Intronic
1181114077 22:20620489-20620511 CCTTTCTCCCCTCCACCCTCTGG + Intergenic
1181805449 22:25372095-25372117 GCTCTCTCCCCTCCATCCCCCGG + Intronic
1182143668 22:27983623-27983645 CCACCCTCTGATCCACCCTCGGG + Exonic
1184235292 22:43180028-43180050 TCGCTCACCCATCCACCCACCGG + Intronic
1184448445 22:44568190-44568212 CCACTTTGCCATCCACTCTCTGG - Intergenic
1184667614 22:45997017-45997039 GCACTCTCCCCTGAACCCTCAGG - Intergenic
1184786106 22:46672713-46672735 GGACTCTCACATCCAGGCTCAGG + Intronic
950508934 3:13414203-13414225 GCCACCTCCCATCCACCCGCGGG + Intronic
950693474 3:14679456-14679478 GCACTCAACCATCCACCTCCAGG - Intronic
951193955 3:19803701-19803723 GCCCTCTCCACTCCACCCCCAGG + Intergenic
951193993 3:19803927-19803949 GCACTCTCCGCTCCACACCCAGG + Intergenic
952319244 3:32260170-32260192 CCACTTTGCCATCCACTCTCCGG - Intronic
958846345 3:99269540-99269562 CCACTCTCCCATCCCAGCTCTGG - Intergenic
960059895 3:113310240-113310262 GTACTCTCCCCTCTCCCCTCAGG + Intronic
961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG + Intronic
961488199 3:127232277-127232299 GGACTCTGTGATCCACCCTCAGG + Intergenic
963240967 3:143001884-143001906 GCACTCACGCCTCCACCCACTGG - Intronic
963570032 3:146982173-146982195 GCCCTCTCCCACCCATGCTCTGG + Intergenic
966505173 3:180692590-180692612 GTACTCTCCCAGCCAAACTCAGG - Intronic
968511372 4:997334-997356 GCACTCCCACCCCCACCCTCAGG + Intronic
968694819 4:2018868-2018890 GCACTCTCCCCGTGACCCTCTGG + Intronic
969565078 4:7972524-7972546 GCACTGTCCCATCCTCACTGAGG + Intronic
970708502 4:18834046-18834068 GAACTCACTCATCCTCCCTCAGG + Intergenic
972661525 4:41121441-41121463 GCACGCTCCCAAGTACCCTCTGG - Intronic
976641456 4:87343058-87343080 GCACTCTCTCATCCACACTGTGG + Intronic
976874668 4:89837782-89837804 GTAGTCTCCCTTTCACCCTCAGG - Intronic
982219241 4:153110846-153110868 GCACTCTGCCATCATTCCTCTGG - Intergenic
986270719 5:6228410-6228432 TCACTGTCCCCGCCACCCTCTGG + Intergenic
986350812 5:6878047-6878069 TCACGTTCCCAGCCACCCTCAGG + Intergenic
987025912 5:13926196-13926218 ACTCTGTCCCATCCTCCCTCAGG - Intronic
999606699 5:153324442-153324464 TCACTCTCCCATCCCCTCACTGG + Intergenic
999904066 5:156119962-156119984 GCACTCTCCCATGCAGACACTGG + Intronic
1001493106 5:172169329-172169351 CCACTGTCCCATCTACCCACTGG - Intronic
1001925333 5:175631914-175631936 GCATTCTCACATGCACCCTATGG - Intergenic
1002259134 5:177982144-177982166 CCACTCTCCCTCCCACCCCCAGG + Intergenic
1005207420 6:23420747-23420769 GGACTCTCTGATCCACACTCAGG + Intergenic
1006416878 6:33909717-33909739 GGCCACTCCCACCCACCCTCGGG - Intergenic
1006771270 6:36554777-36554799 TGACTCTCCCATCCACCCTGTGG - Intergenic
1009000488 6:57707064-57707086 CCACTCTCCCGTCCACCCACCGG + Intergenic
1009188953 6:60606491-60606513 CCACTCTCCTGTCCACCCACCGG + Intergenic
1011138378 6:84125011-84125033 GCACAATCCCATCCATCTTCAGG + Exonic
1012544079 6:100396372-100396394 GCACTTTCCCATACACACTCAGG - Intronic
1012971076 6:105731818-105731840 GCAGTCTCCCTCCCACCCCCTGG + Intergenic
1015022894 6:128498189-128498211 GCATTCTCCCATCCAAACTACGG + Intronic
1015211993 6:130708920-130708942 ACCCTCTTCCCTCCACCCTCTGG - Intergenic
1016175692 6:141075371-141075393 GCCCTCTCTGATCCACCCCCAGG - Intergenic
1018604809 6:165585625-165585647 GGACTCTCCCTTCGAGCCTCTGG + Intronic
1019261667 7:85259-85281 ACACTCTCCTATACACCCACGGG - Intergenic
1019493465 7:1325595-1325617 GCACTCCCCCATCCCCTCCCTGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019801564 7:3091804-3091826 GCACCCACCCCTCCACCCTCCGG + Intergenic
1020137899 7:5596696-5596718 GCCCTCTCCCAGCCACTCTGAGG + Intronic
1021351733 7:19602387-19602409 GCCCTCTGCACTCCACCCTCAGG - Intergenic
1021783715 7:24132543-24132565 GGATTCTCCCAGCCACCCTGTGG - Intergenic
1022132560 7:27417620-27417642 CCACTATCCCTTCCAGCCTCTGG + Intergenic
1022267505 7:28771785-28771807 CCACCCTCCCACCCACCCACGGG - Intronic
1023497739 7:40815949-40815971 GCACTCTCCATTTCACCCTCAGG - Intronic
1023861395 7:44219558-44219580 CCCCTCTCCCATCCACCCCCAGG + Intronic
1025280180 7:57621233-57621255 GCACTCACCCCTTCACCCTGGGG - Intergenic
1025304553 7:57844268-57844290 GCACTCACCCCTTCACCCTGGGG + Intergenic
1027168619 7:75853899-75853921 GCTCTCTCCGGTCCACCCACTGG + Intronic
1029367321 7:100125009-100125031 GTTCTCTCCCATCTAACCTCAGG + Exonic
1030639258 7:111985569-111985591 GCACTGCCCCAGCCACCCTGAGG + Intronic
1032265761 7:130368839-130368861 GCACTCTCCAGTCTACCTTCAGG + Intergenic
1034273277 7:149813416-149813438 CCTCCCTCCCCTCCACCCTCAGG + Intergenic
1034484076 7:151346506-151346528 CCACCCTCCCCTCCAACCTCTGG + Intronic
1035530840 8:349807-349829 TCCCTGTCCCATCCAGCCTCAGG - Intergenic
1035654080 8:1292405-1292427 GCACTGTCCCATCCTCCAACTGG - Intergenic
1037788493 8:21917339-21917361 TCACTCTACCATGCCCCCTCTGG - Intergenic
1037973557 8:23192322-23192344 CCACTCTCCCTCCCTCCCTCGGG - Intronic
1044554014 8:93542459-93542481 TCACTCTCTCATCCTCCCCCCGG - Intergenic
1045688214 8:104733754-104733776 GCTCTCTCCCAGTCACGCTCTGG - Intronic
1046113289 8:109752861-109752883 ACACTCTTCCATCAACACTCTGG + Intergenic
1047930995 8:129728218-129728240 GCCCTCTCTCCTCCACACTCAGG + Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048510172 8:135054956-135054978 TCACTCTGGCATTCACCCTCTGG - Intergenic
1048868233 8:138776439-138776461 GCAATCGCCCCTCCTCCCTCGGG + Intronic
1048972836 8:139654850-139654872 GCACCCACCCAGCCATCCTCTGG - Intronic
1049337010 8:142092016-142092038 GCTGTCTCCCATTCACCCTTGGG - Intergenic
1049641385 8:143717570-143717592 CCACACTCCCATCCCCTCTCGGG + Intronic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1053270162 9:36744259-36744281 GCACTCAGCCCTCCACCCTGAGG + Intergenic
1053346013 9:37378749-37378771 CCACTGGCCCATCCACCATCCGG + Intergenic
1053370972 9:37561397-37561419 GCACTCTCCTAACCTCCCACTGG + Intronic
1054713073 9:68530690-68530712 CCACCCTCCCCTCCACCATCTGG - Exonic
1054944817 9:70784486-70784508 GCCCTCTCCCCTCAACTCTCAGG + Intronic
1057638073 9:96789791-96789813 CCTCTCTACCATTCACCCTCAGG + Intergenic
1059972378 9:119681028-119681050 GGACTCTCCCATCATTCCTCTGG + Intergenic
1060521773 9:124298150-124298172 GGTCTTTCCCATTCACCCTCGGG - Intronic
1061825753 9:133257273-133257295 GACCTTTCCCATCTACCCTCTGG + Intronic
1062137902 9:134939303-134939325 GCACTCACCCTGCCACCCCCAGG + Intergenic
1062606625 9:137351386-137351408 GCACTCTCGCAGCCACCAACAGG - Exonic
1186180210 X:6966839-6966861 GCACCCACCCAGCCACCTTCAGG + Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1198261537 X:134969285-134969307 GCAGTCTACAAGCCACCCTCAGG - Intergenic
1199606471 X:149583388-149583410 GCCCTCTCACTTCCTCCCTCAGG - Exonic
1199632651 X:149785980-149786002 GCCCTCTCACTTCCTCCCTCAGG + Exonic
1200319722 X:155174820-155174842 GTACTATCCCATCCCCCCTGAGG + Intergenic
1200630258 Y:5574371-5574393 CCACTTTGCCATCCACTCTCCGG - Intronic