ID: 1049952354

View in Genome Browser
Species Human (GRCh38)
Location 9:657644-657666
Sequence CTGTAACCAGAGACTGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049952354_1049952357 5 Left 1049952354 9:657644-657666 CCAAATTCAGTCTCTGGTTACAG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1049952357 9:657672-657694 CCCATAACCATTTTCAGGTGAGG No data
1049952354_1049952355 0 Left 1049952354 9:657644-657666 CCAAATTCAGTCTCTGGTTACAG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1049952355 9:657667-657689 CTTTTCCCATAACCATTTTCAGG No data
1049952354_1049952360 22 Left 1049952354 9:657644-657666 CCAAATTCAGTCTCTGGTTACAG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1049952360 9:657689-657711 GTGAGGTGCGTATGCTGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049952354 Original CRISPR CTGTAACCAGAGACTGAATT TGG (reversed) Intronic
903010888 1:20329788-20329810 CTGAGACCAGAGACTGACTCTGG - Intronic
903256322 1:22103773-22103795 CTGTAGGCAGTGACTGAATGTGG - Intergenic
906042366 1:42797881-42797903 GTGGAACCTGAGACTGCATTGGG + Intergenic
907384114 1:54114802-54114824 CTGAAGCCAGAGACTGCATCTGG - Intergenic
908928650 1:69288930-69288952 CACTAACTAGAGACTGTATTTGG + Intergenic
910199479 1:84684139-84684161 CTATAACCAATGATTGAATTTGG - Intronic
911889760 1:103353382-103353404 CCTTCACCAGAGACTGAATGTGG + Intergenic
912596547 1:110883706-110883728 CTCTAATAAGAAACTGAATTTGG - Intronic
918316261 1:183325055-183325077 CTCTACCCAGAGACACAATTTGG - Intronic
918472246 1:184886188-184886210 CTGCCACCAGAGACAGAGTTAGG + Intronic
920591909 1:207228309-207228331 CTGAAACCAGAGACAGAAAATGG + Intergenic
921560830 1:216656243-216656265 ATGGCACCAGGGACTGAATTGGG + Intronic
924787228 1:247210183-247210205 CTGTAACCAAGTTCTGAATTTGG + Intergenic
1064152274 10:12874926-12874948 CTGTAACCAGTGGCAGATTTGGG - Intergenic
1073031965 10:100533688-100533710 CTGTAACAAGAGATTGAATTAGG - Intronic
1073135108 10:101216007-101216029 CTGGAATCAGAGACTGAAGGAGG + Intergenic
1075000546 10:118793865-118793887 CTGCAACCACAGACTGGTTTGGG - Intergenic
1077746200 11:4908879-4908901 CTGTAAACATGGATTGAATTTGG + Intronic
1077759144 11:5071973-5071995 CTGTAACCACAGCATGAATCAGG - Intergenic
1078381601 11:10847132-10847154 CCATAACCTGAGAATGAATTAGG + Intronic
1082249236 11:49960975-49960997 CTGTCAGCAGAGATTGTATTGGG - Intergenic
1086434584 11:86768952-86768974 CTAAAAGCAGAGACTGAGTTGGG + Intergenic
1091466369 12:688275-688297 ATGTAAGCAGAGAGTTAATTTGG + Intergenic
1093241688 12:16684653-16684675 CTGTAAGCAGATACTAAAGTAGG - Intergenic
1094576113 12:31687257-31687279 CTGTAACCATAGATTGTATCTGG - Intronic
1095533282 12:43216072-43216094 CTGAGACATGAGACTGAATTTGG + Intergenic
1096756498 12:53804028-53804050 CTGAAACCAGAGACTAAGTTTGG + Intergenic
1097155758 12:57011191-57011213 CTGGGACCAGAGACTGAGTCTGG - Intronic
1099803712 12:87490177-87490199 CTGTATCTAGAGAGTGATTTTGG - Intergenic
1101741612 12:107504144-107504166 CTGTAATCAGCTCCTGAATTTGG + Intronic
1102427679 12:112857237-112857259 CAGTCACCAGAGCCTGATTTGGG - Intronic
1105828098 13:24140539-24140561 CTGTAGGGAGAGGCTGAATTTGG - Intronic
1109257743 13:60103784-60103806 CTGTCACAAGAGAGGGAATTAGG - Intronic
1109550351 13:63888823-63888845 CTCTAACCATAGTCTGAATAAGG + Intergenic
1111621767 13:90733270-90733292 TTGTAATCAGAGCCTGAGTTTGG - Intergenic
1112354053 13:98659961-98659983 CTGTAGGCAAAGACTGAATTGGG - Intergenic
1113710078 13:112457425-112457447 CTATAACCAGAAAATAAATTTGG + Intergenic
1117235046 14:53764696-53764718 TTGTAATGAGAGAATGAATTTGG - Intergenic
1117812297 14:59560653-59560675 CTGGAACCAGAAACTGAAGGAGG - Intronic
1120769528 14:88363744-88363766 TTGTAAACAGAGAATGCATTCGG + Intergenic
1122752229 14:103945452-103945474 CTGTAATCAGAGAATTATTTGGG - Intronic
1123137686 14:106044815-106044837 GTGGAACCAGAGTTTGAATTAGG + Intergenic
1123203463 14:106690954-106690976 ATGGAACCAGAGCTTGAATTAGG + Intergenic
1124452521 15:29809134-29809156 CAGTATTCAGAGACTGAATATGG + Intronic
1124460972 15:29891313-29891335 CTGTGACCAGAGTTTGAAATCGG + Intronic
1126382014 15:48058484-48058506 CAGTCACCTGAGACTGAATTGGG - Intergenic
1127822936 15:62676098-62676120 CTGCATCCAGGGACTGAAGTAGG + Intronic
1128837815 15:70825453-70825475 CTATAACCAGAGAGTGCAGTAGG - Intergenic
1131166998 15:90149425-90149447 CTGATAGCAGAGACTGAATTGGG - Intergenic
1133369519 16:5237517-5237539 ATATAACCAGAGGATGAATTGGG + Intergenic
1134101414 16:11454712-11454734 CTGTAACTAATTACTGAATTGGG - Intronic
1138443389 16:57048053-57048075 CTGTAACCAGAGACTGGACCTGG + Intronic
1139405943 16:66717825-66717847 ATGTCACCAGAGAATGAACTAGG + Intergenic
1143302399 17:5920224-5920246 CTTTAAGCAGAGAATGAACTTGG - Intronic
1145956337 17:28857405-28857427 CAGTAAACAGAGAATGAAATCGG - Intronic
1147701444 17:42398158-42398180 CTGCAATCAGACACTGAAATGGG + Intergenic
1147934115 17:44001725-44001747 CAGTCAGCAGGGACTGAATTGGG + Intronic
1150162332 17:62908950-62908972 CTCTCAACAGAGAGTGAATTAGG + Intergenic
1150759343 17:67946160-67946182 CTGTAACCACATTCTGAATCTGG - Exonic
1151145784 17:72039635-72039657 CTGCAACCATACACAGAATTAGG - Intergenic
1153178448 18:2405770-2405792 CTGAAAACAGACACTGCATTGGG + Intergenic
1157514748 18:48302905-48302927 CAAAAACCAGAGACTGCATTTGG - Intronic
1157916639 18:51670083-51670105 CTGCAAGAAGAGACTGAATGGGG + Intergenic
1158899159 18:61946622-61946644 CTGTACCAAGAGACTGAATCAGG + Intergenic
1163602768 19:18258751-18258773 CTGTACCCTGAGAGTGATTTGGG + Intronic
1164209080 19:23082178-23082200 GTGTCACCAGAGACTAAAGTGGG - Intronic
1166374519 19:42320161-42320183 CAGAAGCCAGAGACTGAAATGGG - Intronic
926940863 2:18135239-18135261 CTGTAACACCATACTGAATTAGG - Intronic
934148001 2:89114742-89114764 CTGTAGCAAGAGTATGAATTAGG + Intergenic
934221284 2:90085866-90085888 CTGTAGCAAGAGTATGAATTAGG - Intergenic
935233841 2:101121476-101121498 CTGTCACCAGACACTGAATCTGG - Intronic
936150924 2:110022069-110022091 CTATGACCAGGGACTGACTTGGG + Intergenic
936151933 2:110026736-110026758 CTGAGACCTGAGACTGAGTTTGG + Intergenic
936192744 2:110344677-110344699 CTGAGACCTGAGACTGAGTTTGG - Intergenic
936193752 2:110349300-110349322 CTATGACCAGGGACTGACTTGGG - Intergenic
936609722 2:113990090-113990112 CAGGAACCAGAGATTTAATTAGG - Intergenic
937141309 2:119603928-119603950 CTGTAATTAGAAACTGACTTTGG - Intronic
937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG + Intergenic
938341291 2:130538279-130538301 CTATAAAAAGAGACTGAATGCGG + Intergenic
938348540 2:130582430-130582452 CTATAAAAAGAGACTGAATGCGG - Intronic
939909038 2:147957405-147957427 CAGTAACCAGAAAATGAAGTTGG + Intronic
941976626 2:171412437-171412459 CTCTTACCAGAGATTGATTTGGG - Intronic
945802867 2:214455080-214455102 CTGTCAGCATAGAATGAATTAGG + Intronic
946344175 2:219094868-219094890 CTGTAACCAGAGCCTAGATTTGG - Intronic
946694588 2:222341486-222341508 CTGTAAACAGACACTGTTTTAGG + Intergenic
947051874 2:226054176-226054198 GTGTAAACTGAGATTGAATTTGG - Intergenic
947141397 2:227022227-227022249 CTTTAACCAGAGACTGTAGAAGG - Intronic
1168738677 20:168874-168896 CTGTGAACTGAGACTGAAATGGG - Intergenic
1170703547 20:18725696-18725718 CTGTAAGCAGAGGGTGACTTGGG - Intronic
1172244825 20:33438700-33438722 CTGAAAACAGAAACAGAATTTGG - Intronic
1172760293 20:37316649-37316671 CTGTGAGCATAGACTGTATTAGG + Exonic
1174502749 20:50997554-50997576 CTTTCAACAGAGACTAAATTGGG - Intergenic
1175711280 20:61223069-61223091 CCGTCTCCAGAGACTGATTTTGG - Intergenic
1177095514 21:16826969-16826991 CTGTCTCCAGACACTGAATCTGG + Intergenic
1177309212 21:19366197-19366219 CTATCAGCAGAGACTGAATAAGG - Intergenic
950753743 3:15154903-15154925 ATGTAACAAGAGACTAAACTTGG - Intergenic
950938999 3:16874318-16874340 CAGCAACCAGAGACTGTAATGGG - Intronic
952486326 3:33815216-33815238 TTGTAACCATAGGTTGAATTGGG + Intronic
953735095 3:45487143-45487165 CTGTAACCACAGAATGTATTTGG - Intronic
956240769 3:67127664-67127686 GTGTTACCATACACTGAATTAGG + Intergenic
957073401 3:75582558-75582580 ATATAACCAGAGAATGGATTTGG - Intergenic
959349344 3:105241143-105241165 TTGTAACTAGAGACTTTATTTGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961154364 3:124666302-124666324 CTCTAGGAAGAGACTGAATTAGG - Intronic
963276845 3:143340183-143340205 CTGGAACCTAAGACTGTATTAGG - Intronic
967496746 3:190150319-190150341 GTGTAAACACAGTCTGAATTTGG + Intergenic
968048484 3:195637145-195637167 ATGTTGCCAGAGACTGAACTGGG + Intergenic
968098918 3:195952476-195952498 ATGTTGCCAGAGACTGAACTGGG - Intergenic
968155464 3:196377514-196377536 CTGTAAGAAGAAACTGAATTTGG + Intronic
968306124 3:197652774-197652796 ATGTTGCCAGAGACTGAACTGGG - Intergenic
969841152 4:9883266-9883288 TTATTACCAGAGACTGGATTTGG + Intronic
974721437 4:65744127-65744149 CTGTAACTTAAGACTGAATAGGG - Intergenic
975911740 4:79275282-79275304 CTGTATTCAGAGACAGAACTTGG - Intronic
976835809 4:89371905-89371927 CTGTAATCAGAGTCTGGCTTCGG + Intergenic
979505580 4:121491905-121491927 CTGTAGAAAGATACTGAATTAGG - Intergenic
979553604 4:122019348-122019370 CTGTATTCACAGACTGTATTGGG - Intergenic
979647778 4:123092235-123092257 GTGAAACCAGAGGCAGAATTAGG - Intronic
979872147 4:125836666-125836688 CGTTAACTAGATACTGAATTCGG + Intergenic
980496235 4:133589698-133589720 CTGTTACCAGAGACTCCCTTTGG - Intergenic
981353877 4:143764875-143764897 CTGTTACCAGACACTGAACCTGG + Intergenic
982543624 4:156707175-156707197 CTATAGCCAGATACTGAAGTTGG + Intergenic
984086529 4:175319671-175319693 CTGTAAACAGAGATTGATTCTGG - Intergenic
985519007 5:362244-362266 CCCTCACCAGAAACTGAATTTGG + Intronic
986021217 5:3805334-3805356 CAATAACCAGAGAGTGAATGTGG - Intergenic
987813898 5:22875561-22875583 TGGTTACCAGAGACTGAATAAGG - Intergenic
991659816 5:68939147-68939169 CTGTAGTCAGAGCCTGAGTTGGG - Intergenic
993652439 5:90538185-90538207 ATATAACAACAGACTGAATTCGG + Intronic
995630754 5:114129494-114129516 TTGTGACCACAGACAGAATTAGG - Intergenic
1001469858 5:172004518-172004540 TTGTAACCATACACTGACTTGGG + Intronic
1004372820 6:15067188-15067210 CCCTAGCCAGAGACTGGATTAGG + Intergenic
1005356413 6:24988026-24988048 CTCTACTCAAAGACTGAATTGGG + Intronic
1008618797 6:53251717-53251739 CTGGAACCTGAGACTGACCTTGG + Intergenic
1010025414 6:71210160-71210182 CTCTAACAATAGAATGAATTTGG + Intergenic
1011488135 6:87864463-87864485 CTGTAAACAGTGACTGACATGGG - Intergenic
1012524398 6:100160148-100160170 CTAGAAGCAGAGACTGAATTAGG + Intergenic
1012945352 6:105460153-105460175 GAGTAACCAGAACCTGAATTGGG - Intergenic
1016473503 6:144400693-144400715 CTGTATCAAGAGAATGAATGCGG + Intronic
1016583391 6:145655412-145655434 CTGTACCCAGGCACTGAAATAGG + Intronic
1018572435 6:165225344-165225366 GTGGTACCAGTGACTGAATTGGG - Intergenic
1021173554 7:17423721-17423743 CTGAAACAAGTGACTAAATTTGG - Intergenic
1023563045 7:41495782-41495804 CTTTGGCCAAAGACTGAATTTGG - Intergenic
1026017976 7:66685777-66685799 CTCTAGCCAGAGACTGACATAGG - Intronic
1026456887 7:70580522-70580544 TTGTATCCTGAGGCTGAATTCGG - Intronic
1030730510 7:112982480-112982502 CTGTACTTAGAGACTGAAATAGG - Intergenic
1035456083 7:159009827-159009849 CTGTAACCAGAGGAAGAATTAGG - Intergenic
1035736408 8:1890379-1890401 CTGTGAGGAGACACTGAATTGGG + Intronic
1038135679 8:24783096-24783118 CTGGAACCAGAGACCAAATGAGG + Intergenic
1038604461 8:28985217-28985239 CTCTCACCAGACACTGAATCTGG - Intronic
1044664781 8:94623766-94623788 CTCTTACTAGCGACTGAATTAGG + Intergenic
1044911832 8:97068058-97068080 CTGAAACCTAAGACAGAATTGGG + Intronic
1046189325 8:110770495-110770517 CTAAAACCAGAAAATGAATTAGG - Intergenic
1048178455 8:132173550-132173572 GTGAAACCCGAGACTTAATTGGG - Intronic
1048628863 8:136218271-136218293 TTGAAACTGGAGACTGAATTTGG + Intergenic
1049952354 9:657644-657666 CTGTAACCAGAGACTGAATTTGG - Intronic
1052045560 9:23790109-23790131 CTCTAACCAAAGAATGATTTAGG - Intronic
1052615663 9:30837410-30837432 CTGAAAACAGAGAATGAATTGGG + Intergenic
1052822949 9:33153686-33153708 CTATAACCAGAAACTGAATTAGG + Intronic
1054737317 9:68768402-68768424 ATGTAGCCAGAGACAGAAGTTGG + Intronic
1055696465 9:78890238-78890260 CTGTATCCAGACATTGCATTTGG - Intergenic
1061532405 9:131225120-131225142 CTGTACCCAGTGTCTGAATTAGG - Intronic
1203624679 Un_KI270750v1:2766-2788 CTTTAACCATAGAAGGAATTTGG - Intergenic
1192052264 X:67735421-67735443 CTGTAACCAGAGACAGGAAGGGG - Intergenic
1192616691 X:72631460-72631482 CTGTCAGCAGAGACTGAGTGGGG - Intronic
1192947807 X:75984667-75984689 CTCTAACCAGAGTCTGATATTGG + Intergenic
1196683380 X:118491097-118491119 CTGTAAGTAGAAACTGAATAGGG + Intergenic