ID: 1049952710

View in Genome Browser
Species Human (GRCh38)
Location 9:660745-660767
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049952699_1049952710 28 Left 1049952699 9:660694-660716 CCCGAACAATCCTCGGTGAATCT 0: 1
1: 1
2: 0
3: 4
4: 59
Right 1049952710 9:660745-660767 CAGCAACTCTACCACTGGAAGGG No data
1049952700_1049952710 27 Left 1049952700 9:660695-660717 CCGAACAATCCTCGGTGAATCTA 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1049952710 9:660745-660767 CAGCAACTCTACCACTGGAAGGG No data
1049952702_1049952710 18 Left 1049952702 9:660704-660726 CCTCGGTGAATCTAAGAGGAGAG 0: 1
1: 1
2: 0
3: 4
4: 78
Right 1049952710 9:660745-660767 CAGCAACTCTACCACTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr