ID: 1049954287

View in Genome Browser
Species Human (GRCh38)
Location 9:677874-677896
Sequence TAGCCCTGCCCAATATTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049954287_1049954291 20 Left 1049954287 9:677874-677896 CCGTGAAATATTGGGCAGGGCTA 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1049954291 9:677917-677939 CGGTAAGTATATCCACCTGCCGG No data
1049954287_1049954288 0 Left 1049954287 9:677874-677896 CCGTGAAATATTGGGCAGGGCTA 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1049954288 9:677897-677919 TTTCTCCACATGTAAACCATCGG No data
1049954287_1049954292 26 Left 1049954287 9:677874-677896 CCGTGAAATATTGGGCAGGGCTA 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1049954292 9:677923-677945 GTATATCCACCTGCCGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049954287 Original CRISPR TAGCCCTGCCCAATATTTCA CGG (reversed) Intronic
902152786 1:14458454-14458476 TAGCACTGGCCAAGATTACAAGG - Intergenic
902672342 1:17983513-17983535 TAGCACTGCCCACTATTACTGGG - Intergenic
905535530 1:38718784-38718806 TAATCCTGCCTAATATTCCATGG + Intergenic
905543044 1:38775330-38775352 TAGTCCTGGCCCATATTTCCAGG + Intergenic
917648375 1:177050594-177050616 TAGCCTTCCCCAAGATTGCAAGG - Intronic
920702255 1:208226634-208226656 CAGACCTGCCCCATATGTCATGG + Intronic
1063956109 10:11268930-11268952 TATCCCTGCCCTGTGTTTCATGG + Intronic
1069047683 10:63760423-63760445 TATTCTTTCCCAATATTTCATGG + Intergenic
1073628616 10:105124832-105124854 TACCCCTGCACATTATTACAAGG - Intronic
1075580531 10:123614481-123614503 TCCCCCTGCCCAGAATTTCAAGG + Intergenic
1078564502 11:12403004-12403026 TAGCCCTGCCCATTAAATCTTGG + Intronic
1079819673 11:25109629-25109651 TATGCCTGCATAATATTTCATGG + Intergenic
1088190594 11:107223958-107223980 TAGCTCTGGCTAATATTTAAGGG + Intergenic
1089193929 11:116680194-116680216 TGGCTCTCCCAAATATTTCAAGG + Intergenic
1091066999 11:132524019-132524041 TAGCCTTTCCAAATATGTCATGG + Intronic
1095192333 12:39271943-39271965 TGGCCCTGCCCATTATTCCTAGG + Intergenic
1100646988 12:96542019-96542041 CAGCCCTGTACTATATTTCATGG + Intronic
1103229503 12:119316852-119316874 TAGCCCAGCCCATTACTTCTGGG + Intergenic
1109085264 13:57963242-57963264 TATGGCTGCACAATATTTCATGG - Intergenic
1110895692 13:80749529-80749551 TATCACTGCCCAAGAGTTCAAGG + Intergenic
1111506005 13:89189034-89189056 TAGCTTTGCCCTATATTTTAAGG + Intergenic
1114631614 14:24162963-24162985 TAGGCCTGGGCAATATTTAAGGG + Exonic
1116410767 14:44620322-44620344 TAGTCCTTCCTCATATTTCACGG + Intergenic
1121739524 14:96241651-96241673 CTGCCCTGCCCAATTTTGCAGGG + Exonic
1122662007 14:103302191-103302213 TGGACCTGCCCCATATTTCCTGG - Intergenic
1122671718 14:103377958-103377980 CAGACCTGCCCATTATTGCAGGG - Intergenic
1202865591 14_GL000225v1_random:115006-115028 GAGCCCTGGCCAGAATTTCACGG + Intergenic
1125194963 15:37035421-37035443 TATCCCTGACCAATATGTAATGG + Intronic
1126478157 15:49088977-49088999 TAGCACTGCCAATTATTCCAAGG - Intergenic
1126536361 15:49769753-49769775 TAGCACTCCCCAACATTTAAAGG - Intergenic
1127686129 15:61346754-61346776 TAGCCTTGCCCACTTTTTGAGGG - Intergenic
1128289665 15:66467932-66467954 TATCCCTGCCAAATATTATAAGG - Intronic
1132773273 16:1576949-1576971 TAGCACTGCACAACATTTTAAGG - Intronic
1133337391 16:5014968-5014990 TAGCCGGGCCCAGTGTTTCAGGG + Exonic
1138807745 16:60110849-60110871 TAGCCTTACCCAAGTTTTCAAGG - Intergenic
1149472431 17:56928394-56928416 TATCCCTGCCAAATACTACAAGG + Intergenic
1154280916 18:13002631-13002653 CAGCCCTGCCCAGCATTTGATGG + Intronic
1155080705 18:22407326-22407348 TAGCTCTGCCTGAGATTTCATGG + Intergenic
1157182562 18:45510515-45510537 CAGCCTGGCCCAATCTTTCATGG + Intronic
1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG + Intergenic
927382753 2:22498115-22498137 GAGCCCTGCCCAAGACTTCATGG - Intergenic
928907121 2:36380334-36380356 CAGCACTGCCCACTATGTCATGG + Intronic
929899011 2:45985444-45985466 TATCCCTGCCTAGTAGTTCACGG - Intronic
930298375 2:49583715-49583737 TAGCCATCTCCAGTATTTCATGG + Intergenic
930766488 2:55090615-55090637 AAGCCCTACTCCATATTTCATGG - Intronic
931110972 2:59111193-59111215 CAGCCCTCACCAATATTTCCTGG + Intergenic
939339302 2:140873187-140873209 TATCCCTGCCGAATATTATAAGG + Intronic
939994019 2:148903146-148903168 TAGTCCTACCCTAGATTTCATGG + Intronic
940060504 2:149560456-149560478 TAGTCCTGCCCTTTATTTCTTGG - Intergenic
941412544 2:165177699-165177721 TGGCCCTGCTCAATTTCTCAGGG + Intronic
943751563 2:191514841-191514863 TAGCCCTTCCTAATTTTTCATGG - Intergenic
944065897 2:195618560-195618582 TAGGCATGGCCAATTTTTCATGG + Intronic
945487399 2:210413195-210413217 TGGCCCTGGCAAAGATTTCATGG - Intergenic
945975595 2:216268101-216268123 TGGCCCAGCCCAATATTGCTGGG + Intronic
946612779 2:221477332-221477354 TAGCAGTGCCCACCATTTCAGGG - Intronic
952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG + Intronic
958710824 3:97715085-97715107 CATCCCTGGCCAATAATTCATGG - Intronic
959869809 3:111313493-111313515 TACCCCTGCCCCATCTTTCCTGG - Intronic
960928832 3:122823337-122823359 TGGCCCTGGCCTATATATCAGGG - Intronic
962009955 3:131382668-131382690 TAGCCCTGCCTGAAATATCAGGG - Exonic
963540690 3:146583775-146583797 TAGCTCTGTCCAATATTTTAGGG + Intronic
963717551 3:148821306-148821328 TAGCCCTGCAAAGTCTTTCATGG - Intronic
964005922 3:151828871-151828893 AAGCCCATCCCAATATTGCAGGG + Intergenic
965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG + Intronic
965893224 3:173540601-173540623 TGGCCCTGCTTAAGATTTCATGG - Intronic
973642040 4:52913152-52913174 GTGCCCTGCCCAATCATTCAGGG + Intronic
975216661 4:71763027-71763049 TTGCCTTGCCCAATTTTTCTTGG - Intronic
976940878 4:90700808-90700830 TATCCTTGCCCAATTTTTGATGG + Intronic
979754507 4:124324474-124324496 TAGCCATGCCCAATGTATCTAGG - Intergenic
980026387 4:127772622-127772644 TAGCCTTTTCTAATATTTCAAGG + Intronic
981292550 4:143092820-143092842 TATCCCTGCCAAATACTACAAGG + Intergenic
981620019 4:146685355-146685377 TATCCCTGCCCAATGTTTGGAGG + Intergenic
985672959 5:1215593-1215615 TAGGGCTGAGCAATATTTCATGG + Intronic
987656318 5:20811886-20811908 TTGCCCTGCCAAATATCACAGGG + Intergenic
988767239 5:34392052-34392074 TTGCCCTGCCAAATATCACAGGG - Intergenic
989008277 5:36840140-36840162 TATCCTTGCCCAATTTTTAATGG + Intergenic
989335389 5:40310446-40310468 TTGCCCTCCCCCATATTTCTGGG - Intergenic
989736231 5:44710157-44710179 TGACCCTGCCCATTATTTCAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990848398 5:60172387-60172409 GAGCCCTTCCCAGTATTTCTGGG + Intronic
992993870 5:82313485-82313507 AAGCCCTGCCTACTATTTCAGGG - Intronic
1000521188 5:162296586-162296608 TATACCTGCACAGTATTTCATGG + Intergenic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1003278965 6:4675670-4675692 CAGCCCTGCCTAACATTACATGG - Intergenic
1004465014 6:15876958-15876980 TATGGCTGCACAATATTTCACGG - Intergenic
1006506742 6:34493922-34493944 TTGCCCTGTCCAGCATTTCATGG + Intronic
1014110457 6:117615069-117615091 TATCCCTGCCAAATACTACAAGG + Intergenic
1015143103 6:129958057-129958079 TGGCCCTGCCCAATCATGCAAGG - Intergenic
1015493485 6:133854990-133855012 TTGCACTGCCCAATTTGTCAAGG - Intergenic
1024295736 7:47840617-47840639 AAGCCCTGCCCAGCATTGCATGG - Intronic
1031488088 7:122353927-122353949 TAGCCCTGATCAATATGTAAAGG - Intronic
1032128388 7:129210895-129210917 TGGCCCTTCCCAAGATTTGATGG + Intronic
1032698663 7:134359613-134359635 TAGCCATGCCCAATGTCTCTGGG - Intergenic
1033948408 7:146751966-146751988 TAGGCCTGCATAATATTCCATGG + Intronic
1034775861 7:153826030-153826052 TAGCCCTGCACAGTCTTTTATGG + Intergenic
1041389727 8:57337859-57337881 TAGCCCTGCACGAGATATCATGG - Intergenic
1044448633 8:92308256-92308278 TAGCCCTACTCATTATCTCAGGG - Intergenic
1046327733 8:112672114-112672136 TGTCCCTGCCCTATATTTCAAGG - Intronic
1048294482 8:133204438-133204460 TATCCCTGCCCAATGTTCTAAGG + Intronic
1049140216 8:140947777-140947799 CAGCCCTCCCCAATACCTCATGG - Intronic
1049954287 9:677874-677896 TAGCCCTGCCCAATATTTCACGG - Intronic
1051762190 9:20479819-20479841 TTTCCCTGCAAAATATTTCATGG - Intronic
1052206702 9:25850185-25850207 TATCCCTGCCAAATACTTCAAGG + Intergenic
1187216025 X:17277362-17277384 TAGCCTTTCCCAGTATTACAAGG - Intergenic
1187726759 X:22211304-22211326 AAGCCTTGCCCTATCTTTCATGG + Intronic
1195139871 X:101948568-101948590 TGGCTCTGCCCTATCTTTCAGGG + Intergenic
1196772843 X:119312288-119312310 TATCCCTGCCAAATACTACAAGG + Intergenic
1196884535 X:120230610-120230632 TATCCCTGCCAAATATTATAAGG + Intergenic
1197045817 X:121996931-121996953 TAGCCCTCCCAATTATTTTAAGG - Intergenic
1197663514 X:129198711-129198733 TAGCCATGGTCAATATTTGAAGG + Intergenic
1200285521 X:154818574-154818596 TATCCCTGCCAAATATTATAAGG - Intronic