ID: 1049956408 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:696934-696956 |
| Sequence | ATTGATGCACAGATGAAGAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049956403_1049956408 | 17 | Left | 1049956403 | 9:696894-696916 | CCCTAGTGGCAGGCTGACTGCAC | 0: 1 1: 0 2: 0 3: 11 4: 91 |
||
| Right | 1049956408 | 9:696934-696956 | ATTGATGCACAGATGAAGAAAGG | No data | ||||
| 1049956404_1049956408 | 16 | Left | 1049956404 | 9:696895-696917 | CCTAGTGGCAGGCTGACTGCACT | 0: 1 1: 0 2: 3 3: 18 4: 193 |
||
| Right | 1049956408 | 9:696934-696956 | ATTGATGCACAGATGAAGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049956408 | Original CRISPR | ATTGATGCACAGATGAAGAA AGG | Intronic | ||
| No off target data available for this crispr | |||||