ID: 1049956408

View in Genome Browser
Species Human (GRCh38)
Location 9:696934-696956
Sequence ATTGATGCACAGATGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049956403_1049956408 17 Left 1049956403 9:696894-696916 CCCTAGTGGCAGGCTGACTGCAC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG No data
1049956404_1049956408 16 Left 1049956404 9:696895-696917 CCTAGTGGCAGGCTGACTGCACT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049956408 Original CRISPR ATTGATGCACAGATGAAGAA AGG Intronic
No off target data available for this crispr