ID: 1049958300

View in Genome Browser
Species Human (GRCh38)
Location 9:713209-713231
Sequence GCTCCACTTGGAATGATGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049958293_1049958300 13 Left 1049958293 9:713173-713195 CCTGTAGGGGAATCTCTGGAGAA 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1049958300 9:713209-713231 GCTCCACTTGGAATGATGACTGG 0: 1
1: 0
2: 0
3: 13
4: 92
1049958294_1049958300 -10 Left 1049958294 9:713196-713218 CCCCCAGCCTCAAGCTCCACTTG 0: 1
1: 0
2: 3
3: 29
4: 290
Right 1049958300 9:713209-713231 GCTCCACTTGGAATGATGACTGG 0: 1
1: 0
2: 0
3: 13
4: 92
1049958292_1049958300 14 Left 1049958292 9:713172-713194 CCCTGTAGGGGAATCTCTGGAGA 0: 1
1: 0
2: 1
3: 16
4: 144
Right 1049958300 9:713209-713231 GCTCCACTTGGAATGATGACTGG 0: 1
1: 0
2: 0
3: 13
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049958300 Original CRISPR GCTCCACTTGGAATGATGAC TGG Exonic
903546141 1:24124463-24124485 GCCCCACTTGGACTGGTGACAGG - Intronic
906725284 1:48040038-48040060 GCTGCACTTGGAATGAGGGTAGG + Intergenic
917599439 1:176559755-176559777 GTTCCACTTGGAATGATCCGAGG + Intronic
919805359 1:201378115-201378137 GCTCCACTTGAACTGATGCTGGG + Intronic
920071990 1:203308592-203308614 GCTCTCCTTGGGATGATGGCTGG + Exonic
923218495 1:231871896-231871918 GCTCTCCTTTGAATTATGACAGG - Intronic
923225326 1:231933909-231933931 GCACTACTTGGAAACATGACTGG + Intronic
924671779 1:246135253-246135275 GCTCCACATAGAAGGATGAATGG - Intronic
1063989203 10:11542061-11542083 GTTCCACTTGGAATACCGACTGG + Intronic
1065063762 10:21937531-21937553 ACTCCACTTTTAATAATGACTGG + Intronic
1066176139 10:32908498-32908520 GCTACAATTGGAATGATGTCTGG + Exonic
1067974604 10:51010075-51010097 GCTCCACTGGGAAGCATGATTGG + Intronic
1069840243 10:71335330-71335352 GCTCCACTTGGAGAAATGATGGG - Intronic
1076277236 10:129211984-129212006 GCTCTGCTTGGAGTGATGATGGG - Intergenic
1076661196 10:132057042-132057064 GCTCCGCTTGGGATGAGCACTGG - Intergenic
1078173811 11:8953142-8953164 ACTTCACATCGAATGATGACAGG + Intronic
1078898165 11:15616533-15616555 GCTTTAATTGGAATGATGCCGGG + Intergenic
1081193486 11:40133113-40133135 GCTTCCTTTGGATTGATGACTGG + Intronic
1084729015 11:71061419-71061441 GCCCCACTTAGGCTGATGACAGG + Intronic
1086191772 11:84087814-84087836 GATAAACTTGGAATGTTGACAGG - Intronic
1086510016 11:87546157-87546179 GCTCCACTTCTATTAATGACAGG + Intergenic
1086571567 11:88291020-88291042 CCTCCATTTGGAATGATGAAGGG + Intergenic
1087070816 11:94078603-94078625 GCTCCAGTTAGAAAGCTGACAGG + Intronic
1088110815 11:106259370-106259392 GCTCCACTTGGATTGCAGATAGG + Intergenic
1090601216 11:128373890-128373912 GCTCAAGTAGGAAAGATGACAGG + Intergenic
1092836404 12:12493151-12493173 TCTCCACTTGGAAGTATAACAGG + Intronic
1099022346 12:77422300-77422322 CCTACAGTTGGATTGATGACAGG + Intergenic
1103693138 12:122792151-122792173 CCTAGACTTGCAATGATGACAGG + Intronic
1111586796 13:90292124-90292146 GCTCCAGATGGAATGATGTATGG + Intergenic
1111995173 13:95158455-95158477 GCTCACCTTGGGATGGTGACTGG - Intronic
1114855012 14:26428105-26428127 ACTCAACTTAGCATGATGACTGG - Intergenic
1116972347 14:51079675-51079697 TCTTCACTGGGAATGATGCCAGG + Intronic
1117047510 14:51828130-51828152 GCTCCCCTGGGGATGATGGCAGG - Intronic
1119664942 14:76478680-76478702 CTTCCCCTTGGAATGGTGACAGG - Intronic
1121085843 14:91145527-91145549 GCTCCACCAGGACTGAGGACAGG + Intronic
1122248560 14:100422142-100422164 GCTCCACTTGGTATCATGTGGGG + Intronic
1123921726 15:25074800-25074822 GACCCACATGGAATGATGCCAGG - Intergenic
1125740395 15:41958958-41958980 GTTCCACTGGGAATGTTTACAGG + Intronic
1129413386 15:75361786-75361808 GCTCGACTTGGAGTGCTGAGGGG - Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1135721387 16:24821419-24821441 GCTCCCGTTGGAGTGATGAGAGG + Intronic
1139096528 16:63711065-63711087 TCTCCACTTGGAATTGTAACAGG + Intergenic
1140431114 16:74904140-74904162 GCACCACTTGGAAATATGACAGG - Intronic
1140871964 16:79114727-79114749 GCTCCCCTTGGTTTGTTGACAGG - Intronic
1143598026 17:7927296-7927318 GCTCCATTTGGAAGGCTGAGAGG - Intronic
1145803126 17:27704118-27704140 GCTGGACTTGGAATTAAGACAGG - Intergenic
1146268549 17:31469304-31469326 GGTCCAAATGGAATGAGGACAGG + Intronic
1146354172 17:32120090-32120112 GCTCCACTCGGCATGAAGTCAGG - Intergenic
1147908536 17:43839997-43840019 GCTCCTCTTGGAATTATTTCTGG - Intergenic
1150004961 17:61463710-61463732 TTGCCACCTGGAATGATGACAGG + Intronic
1150352738 17:64458561-64458583 GCTCCACTGCTAATGATGATGGG + Intronic
1152383453 17:79954580-79954602 GGTCCACTTGGGAAGATGTCAGG - Intronic
1155983081 18:32200957-32200979 GCTCCACTTGGAACCATGCCAGG - Intronic
1162000948 19:7744822-7744844 GCTCCACTTGGAAAGAAGGGAGG - Intronic
1163043593 19:14621827-14621849 GCTACAATTGGAATGATGTCTGG + Intronic
1163797074 19:19343856-19343878 GGATCACTTGGAAGGATGACAGG - Exonic
1165900215 19:39166035-39166057 GCTGCTATTGGAATGGTGACCGG + Intronic
926810922 2:16754837-16754859 GCCCCACTTTGAAGGATGAGGGG - Intergenic
928057401 2:28071753-28071775 AGTCAACTTGGAAGGATGACAGG - Intronic
933006285 2:76999565-76999587 ACTCCATTTTGAATCATGACAGG + Intronic
942972805 2:181977894-181977916 GCTCCACTGGGGCTGTTGACAGG + Intronic
944943792 2:204659599-204659621 GCTCCTCTTGGGATGATGTGGGG - Intronic
947522964 2:230862562-230862584 GCTCCCCTTGGATTATTGACTGG + Intergenic
947981283 2:234412126-234412148 CCTCCACTGGGACTGATGATTGG + Intergenic
1170971246 20:21118564-21118586 GATGCACTTGGAATCATGCCTGG - Intergenic
1172803080 20:37591867-37591889 GCTCCTCTTGGAATGAAGGAGGG - Intergenic
1174056097 20:47799549-47799571 GCTCCCCTGGGGATGATGACAGG + Intergenic
1175946913 20:62563233-62563255 GCTCCATTAGGAATATTGACAGG + Intronic
956492237 3:69785455-69785477 GCCCCACTTGGATTGCTTACTGG - Intronic
956506498 3:69945862-69945884 GCCTGACTTGGAATAATGACTGG + Intronic
956707175 3:72009329-72009351 GCTCCACTTGCAAGTAAGACTGG + Intergenic
960155730 3:114295535-114295557 TCTTCCCTAGGAATGATGACAGG + Exonic
961338690 3:126202637-126202659 GCTGCACTTGAAAGGAAGACAGG + Intergenic
969426161 4:7125375-7125397 ACTGCTCTTGGAATCATGACAGG - Intergenic
969463953 4:7343834-7343856 GCTCCACGAGGAAGGTTGACAGG + Intronic
972218449 4:36923891-36923913 GCTCCACCAGGAATGTAGACTGG - Intergenic
973982603 4:56318594-56318616 GCTCCACTGGGAAAGAAAACAGG - Intronic
975723181 4:77267876-77267898 ACTCCAGTTGCAATGGTGACAGG + Intronic
981398349 4:144281306-144281328 GCAGCACTTAGAATGATGGCTGG + Intergenic
986890569 5:12299698-12299720 GCTCCCCTGGGTCTGATGACAGG + Intergenic
1000920136 5:167128431-167128453 GATTCAGTTGGAATGAGGACAGG + Intergenic
1001337645 5:170813266-170813288 GCTCCTCTTGGAATGATACAGGG - Exonic
1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG + Intergenic
1006935093 6:37711702-37711724 GCCCCACAGGGAGTGATGACAGG - Intergenic
1007476970 6:42125393-42125415 GGTCCACGTGGAATGGTGCCTGG + Intronic
1008995232 6:57651313-57651335 ACTTCACTTAGAATGATGAGAGG - Intergenic
1012223086 6:96674871-96674893 CCAGCACTTGGAATTATGACTGG - Intergenic
1015746001 6:136510393-136510415 GATGCACTTGCAATGATGCCTGG - Intronic
1025236899 7:57240605-57240627 GCTCCCCTGGGGATGATGACAGG - Intergenic
1029492157 7:100876855-100876877 GCTAGACTTGGAAAGATGAGTGG + Intronic
1030705888 7:112692408-112692430 GCTCCACTTGGGTGCATGACTGG - Intergenic
1031761691 7:125720722-125720744 ACTCCATTTGGGGTGATGACTGG + Intergenic
1033796821 7:144855095-144855117 GCTCCCCTTGGAATGATGTGTGG + Intergenic
1036607284 8:10318761-10318783 GCTTCACTGGGAAAGATGACTGG - Intronic
1041113377 8:54508684-54508706 TGTCCACTTGGTATGATAACTGG + Intergenic
1042742844 8:72070400-72070422 GCGCCAAATGGAATGATGAATGG - Intronic
1045036807 8:98182225-98182247 CCTCCAGTTGTAATGATGCCAGG - Intergenic
1046088450 8:109468271-109468293 GCTCCATTTGAAATGAGGGCAGG - Intronic
1047535657 8:125717452-125717474 CCTCCACTTGGATGGATGACTGG - Intergenic
1049958300 9:713209-713231 GCTCCACTTGGAATGATGACTGG + Exonic
1059737267 9:117114877-117114899 GCTCCAATGGGGATGTTGACTGG - Intronic
1059835265 9:118144977-118144999 ACTCCATGTGGAATGATGTCAGG + Intergenic
1060496699 9:124124758-124124780 GCTGCACTTGGGAGAATGACTGG - Intergenic
1196683024 X:118487813-118487835 GTACCACTTGGAATAATGAGAGG - Intergenic
1197835401 X:130688988-130689010 CCTGCTCTTGGAATGATGACTGG - Exonic
1198072993 X:133168238-133168260 ACTCCACTAAGAATGATGACAGG - Intergenic