ID: 1049958841

View in Genome Browser
Species Human (GRCh38)
Location 9:718907-718929
Sequence TAAGCCCAAATGATGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049958841 Original CRISPR TAAGCCCAAATGATGGTTTG GGG (reversed) Intronic
904268631 1:29333345-29333367 TCAGCTCAAATCATAGTTTGAGG + Intergenic
905003166 1:34689292-34689314 CAAGCCCAAATGATGACTTTGGG + Intergenic
905198056 1:36296549-36296571 TAAGCCAAAATTAAGGTTTCTGG - Intronic
906655950 1:47548403-47548425 TGAGCTCAACTGATGGTCTGGGG + Intergenic
911626367 1:100129499-100129521 AAGGCCCAAATAATGGTTTAAGG + Intronic
913011051 1:114683977-114683999 TAAGCCTGAATGAGGGTTTAGGG + Intronic
916749844 1:167714155-167714177 TATCCCCAAATGAAGGTTCGGGG + Intergenic
917909448 1:179627332-179627354 TAAGATCAAATGAGGGTTGGGGG + Intronic
918276257 1:182956048-182956070 TCAGCCCAGATGATGGGTTTTGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
921392959 1:214635392-214635414 TAAGCTCTAATGCTGGCTTGTGG + Intronic
923258848 1:232246971-232246993 TAATCCCAAAGGATGATTTTTGG - Intergenic
923286515 1:232501521-232501543 TGAGCCCAAATAATGGGGTGGGG + Intronic
924626068 1:245697603-245697625 AAAGCCCAAGTGTTGGTTTAGGG + Intronic
1063989856 10:11548750-11548772 GAAGAACAAATGATGGTTGGAGG - Intronic
1066343627 10:34560969-34560991 TTATCCCAAATAGTGGTTTGAGG - Intronic
1067795478 10:49318354-49318376 TCAGCCCACGTGATGGGTTGGGG - Intronic
1068733834 10:60389710-60389732 AAAACCCAAATGATGGTGTCCGG + Exonic
1070352543 10:75607018-75607040 GAAGCCCAAATGATATTTTATGG + Intronic
1070774191 10:79100275-79100297 TCAGCCCAAAGGATGAGTTGGGG + Intronic
1071143483 10:82540405-82540427 TCAGGCCAAAAGATGTTTTGGGG + Intronic
1072880053 10:99217816-99217838 TAAGCCAAGAGGATTGTTTGAGG - Intronic
1073790550 10:106936162-106936184 TAAGCACAACTGATGGCTTGAGG - Intronic
1078874663 11:15380890-15380912 GAATCCCAAATGCTGGTGTGAGG + Intergenic
1079867424 11:25754610-25754632 TCACACAAAATGATGGTTTGTGG + Intergenic
1080224234 11:29942833-29942855 TAAGACCCAAAGAAGGTTTGGGG - Intergenic
1081376402 11:42363758-42363780 CATTCCCAAATGCTGGTTTGAGG - Intergenic
1088668075 11:112114585-112114607 TAGGTCCAAATGATTTTTTGCGG + Intronic
1089595179 11:119574142-119574164 TAAGCCAAAAGGAGGCTTTGAGG - Intergenic
1091921355 12:4307592-4307614 TAATCCCAAATCAATGTTTGTGG - Intergenic
1092802788 12:12187316-12187338 TATTCCCAAATGCTTGTTTGGGG - Intronic
1096699468 12:53372572-53372594 TAAGCCCAGCTGATGGTCTCTGG - Intergenic
1096881648 12:54677976-54677998 GAAGTCCAAATGAGGGATTGAGG - Intergenic
1102807228 12:115792755-115792777 TGAGCCCCAGTGATGGATTGAGG - Intergenic
1104119472 12:125785455-125785477 TAAGCTAAAATGTTGGTTTCTGG - Intergenic
1104262068 12:127193745-127193767 TATGCCCTAAAGCTGGTTTGAGG - Intergenic
1104642571 12:130476735-130476757 TAAGCCCAGATGATGGCAAGGGG - Intronic
1109251666 13:60028452-60028474 GAACCCCAAATGCTGGTTTCTGG - Intronic
1109982662 13:69928999-69929021 TATGCTCAAATAATGTTTTGTGG + Intronic
1110165967 13:72443603-72443625 CAATCACAAATGATGGTTTTAGG - Intergenic
1112998732 13:105606391-105606413 TAAGCAAAATTCATGGTTTGAGG + Intergenic
1115056745 14:29137046-29137068 TGAGGCCAGATGATGGTCTGTGG - Intergenic
1115226004 14:31102991-31103013 GAAGTCCAAATGATTCTTTGTGG - Exonic
1116638626 14:47431642-47431664 TTTGCACAAATGAGGGTTTGGGG + Intronic
1127037811 15:54938263-54938285 TTATCTCAAATGAGGGTTTGTGG - Intergenic
1127307579 15:57723134-57723156 TAAAACCAATTGAAGGTTTGTGG + Intronic
1130777121 15:86996072-86996094 TCAGCCCACATGATGGTTATGGG - Intronic
1131801413 15:96073310-96073332 TAAGGCAAGAGGATGGTTTGAGG + Intergenic
1133865809 16:9642347-9642369 TATGCACAAATGATGTTTTCTGG - Intergenic
1143708881 17:8719552-8719574 TGAGCCAGAATGATGGCTTGTGG + Intergenic
1150355242 17:64478241-64478263 TCACCCCAAATGATGTGTTGAGG - Intronic
1150493757 17:65592189-65592211 GAAGCCCAAAGGAGGGTTGGTGG + Intronic
1152127483 17:78455997-78456019 GAAGCCCGAATCATGCTTTGTGG + Intronic
1153987946 18:10369348-10369370 TTAGCTCAAATGGAGGTTTGGGG + Intergenic
1155734759 18:29207829-29207851 AATGTCCAAAAGATGGTTTGAGG - Intergenic
1156281649 18:35645037-35645059 AAAACCCAAATGAGGCTTTGGGG - Intronic
1159306702 18:66652569-66652591 TAAAAATAAATGATGGTTTGGGG - Intergenic
1159842450 18:73415014-73415036 GAAGCCCAAATGATTATTTATGG - Intergenic
1165369013 19:35390890-35390912 TAAGCCCAAATGATGGAGGGAGG - Intergenic
925725924 2:6870903-6870925 CGAGCCAAAATTATGGTTTGAGG + Intronic
926509682 2:13759347-13759369 TAAGCCAAAAGGGTAGTTTGGGG + Intergenic
926860247 2:17301433-17301455 AAAGCCCAAATCAGGGCTTGAGG - Intergenic
931364875 2:61610435-61610457 TACTCCCAAAAGATGTTTTGTGG - Intergenic
935143320 2:100375865-100375887 AAGGCCCATATGGTGGTTTGGGG + Intergenic
935220667 2:101009699-101009721 TAATCCCACAAGATGTTTTGTGG + Intronic
937371820 2:121303691-121303713 AAAGCCCTAATTATGGTTTCTGG + Intergenic
938594508 2:132774077-132774099 TAAAGCCAAATGATGGAGTGCGG - Intronic
943531236 2:189083460-189083482 TCAGCCAAAATTAGGGTTTGGGG + Intronic
944005740 2:194903192-194903214 TAATCCCAAGTGATGGTGTTTGG + Intergenic
1168796761 20:615349-615371 TGAGGCCAAAGGATCGTTTGAGG + Intergenic
1170798492 20:19570673-19570695 TGAACACAAATGATAGTTTGAGG + Intronic
1174398155 20:50260708-50260730 TAAGCCCAGAAGATGGGGTGGGG - Intergenic
1175199884 20:57269617-57269639 TAAGGCTAAATGGGGGTTTGTGG - Intergenic
1181987455 22:26810394-26810416 TAAGACCAAATCATTCTTTGTGG - Intergenic
1185373178 22:50470169-50470191 TGGGCCCAGATGGTGGTTTGGGG - Intronic
951556739 3:23928668-23928690 TAAGCCTAAATCATACTTTGAGG - Intronic
960191639 3:114713541-114713563 TAAAGCCAGATGATGCTTTGAGG - Intronic
965471565 3:169099171-169099193 TATACCAAAATGCTGGTTTGTGG + Intronic
966156384 3:176920948-176920970 CAAGGCCAAATGAAGGTCTGGGG - Intergenic
968174956 3:196541414-196541436 TGAGCCCAGAGGATTGTTTGAGG + Intergenic
972854047 4:43084211-43084233 TAAAACCACATGATGGATTGAGG + Intergenic
974100814 4:57414225-57414247 TAAGTCCAAGTGACGTTTTGGGG + Intergenic
976582951 4:86761562-86761584 TAAGCACCACTGATGGTATGAGG - Intronic
977390320 4:96401203-96401225 ACAGCAGAAATGATGGTTTGTGG + Intergenic
979080183 4:116329022-116329044 TAATCCCTAATGATGGTATTAGG - Intergenic
981269868 4:142832985-142833007 TACGCACAAAGGATTGTTTGGGG + Intronic
983440960 4:167783718-167783740 TAAGCCCAAATGATGATGATGGG + Intergenic
985697374 5:1348311-1348333 TGAGACCAAATGTGGGTTTGTGG - Intergenic
987942460 5:24558368-24558390 TAAACCCAAATTATAGTCTGGGG - Intronic
988710727 5:33771907-33771929 TAATCCCAGAGGATTGTTTGAGG - Intronic
990342650 5:54838988-54839010 TAAGCCCAAGTCTTTGTTTGTGG + Intergenic
991255202 5:64605729-64605751 TAAGGACAACTGCTGGTTTGGGG - Intronic
995957535 5:117796177-117796199 TAAGCCTAAAAGATGTTTTTAGG + Intergenic
998128478 5:139639354-139639376 TAAGCCCAGAGGCTGGTGTGTGG + Intergenic
1000961813 5:167609609-167609631 GAAGACTAAATCATGGTTTGAGG + Intronic
1012497925 6:99855365-99855387 TAAGCTGAAATAATGGCTTGGGG + Intergenic
1014190215 6:118487421-118487443 TGAACCCACATGTTGGTTTGGGG - Intronic
1018012697 6:159686207-159686229 TAAGCACAAATGATGGAATGTGG + Intronic
1019110810 6:169711852-169711874 AAAATCCCAATGATGGTTTGGGG - Intronic
1022835670 7:34111653-34111675 TAAGGCAAAATTATGGTCTGTGG + Intronic
1026814283 7:73497778-73497800 TAAGCCAATGTGATGGTTTTAGG - Intronic
1031208755 7:118794872-118794894 TAAGCCTAATGGATGGTTTGGGG - Intergenic
1037651773 8:20845622-20845644 TAATCCTCAATGATGGTATGTGG - Intergenic
1038094816 8:24296355-24296377 TAAAACCACAAGATGGTTTGAGG + Intronic
1043400649 8:79880963-79880985 TATGGCCAAGTGTTGGTTTGGGG - Intergenic
1043784254 8:84377308-84377330 TTAGCCCACATGATATTTTGAGG - Intronic
1045996821 8:108372836-108372858 TAAGCATAAATGATAATTTGAGG - Intronic
1047068001 8:121308423-121308445 CAAGACCAAATGAAGGTGTGGGG - Intergenic
1047182766 8:122605259-122605281 TAGGCCTAAAGGATGGATTGCGG + Intergenic
1049958841 9:718907-718929 TAAGCCCAAATGATGGTTTGGGG - Intronic
1050283213 9:4074231-4074253 TGAACCCAAACTATGGTTTGGGG - Intronic
1052842624 9:33305997-33306019 TGACTCCAAATGATGTTTTGGGG - Intronic
1055376556 9:75654844-75654866 TAAACCCACAAGATGTTTTGTGG - Intergenic
1055910292 9:81343082-81343104 TAAGGAAAAATGATGTTTTGCGG - Intergenic
1056477666 9:86968496-86968518 AAAGACCAAATGATTGTTTGAGG - Intergenic
1059486654 9:114632479-114632501 GGACCCCAAATGCTGGTTTGGGG - Intronic
1186710325 X:12187964-12187986 TATGCCAGAATGCTGGTTTGGGG - Intronic
1189482203 X:41400742-41400764 TAAAACCAAATGATGGAGTGAGG - Intergenic
1190410239 X:50129884-50129906 TAAGCTGTAATTATGGTTTGTGG + Intergenic
1190443131 X:50495585-50495607 TAAGCACAAATTTTAGTTTGTGG + Intergenic
1193586620 X:83329770-83329792 TAAGCCCATATCATGTGTTGTGG + Intergenic
1195462070 X:105138784-105138806 TACTCCCAAATGCTGATTTGAGG - Intronic
1195790779 X:108582834-108582856 TCAGCACAAATGATGGTGTTAGG - Intronic
1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG + Exonic
1198815228 X:140582642-140582664 TAATGCGAAATGATGGTTTATGG + Intergenic
1198845989 X:140911279-140911301 TAAGCCTGAATGATGTCTTGTGG - Intergenic
1201274104 Y:12282746-12282768 TGAGCATAAATGATAGTTTGAGG + Intergenic