ID: 1049959926

View in Genome Browser
Species Human (GRCh38)
Location 9:728563-728585
Sequence GTGAATCCCCTTACCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049959923_1049959926 18 Left 1049959923 9:728522-728544 CCTGCAAGGCTGTCTCTTGTGGG 0: 1
1: 105
2: 215
3: 338
4: 516
Right 1049959926 9:728563-728585 GTGAATCCCCTTACCTGTCCAGG No data
1049959921_1049959926 19 Left 1049959921 9:728521-728543 CCCTGCAAGGCTGTCTCTTGTGG 0: 2
1: 97
2: 227
3: 332
4: 524
Right 1049959926 9:728563-728585 GTGAATCCCCTTACCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049959926 Original CRISPR GTGAATCCCCTTACCTGTCC AGG Intronic
No off target data available for this crispr