ID: 1049965867

View in Genome Browser
Species Human (GRCh38)
Location 9:779155-779177
Sequence CTGAAATAGTTTGAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049965867_1049965871 19 Left 1049965867 9:779155-779177 CCATTCTCCTCAAACTATTTCAG No data
Right 1049965871 9:779197-779219 ACTTTCAAATTCATTTTATGAGG 0: 7
1: 67
2: 307
3: 1067
4: 3340
1049965867_1049965870 -7 Left 1049965867 9:779155-779177 CCATTCTCCTCAAACTATTTCAG No data
Right 1049965870 9:779171-779193 ATTTCAGAAACTTGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049965867 Original CRISPR CTGAAATAGTTTGAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr