ID: 1049966993

View in Genome Browser
Species Human (GRCh38)
Location 9:788876-788898
Sequence CCTCATTAGACCCTGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049966993_1049967000 -5 Left 1049966993 9:788876-788898 CCAGGGCACAGGGTCTAATGAGG No data
Right 1049967000 9:788894-788916 TGAGGGAAGGCTGGTGTGGGTGG No data
1049966993_1049966998 -9 Left 1049966993 9:788876-788898 CCAGGGCACAGGGTCTAATGAGG No data
Right 1049966998 9:788890-788912 CTAATGAGGGAAGGCTGGTGTGG No data
1049966993_1049967001 18 Left 1049966993 9:788876-788898 CCAGGGCACAGGGTCTAATGAGG No data
Right 1049967001 9:788917-788939 CACCTCTGCACCACACTGAGTGG No data
1049966993_1049966999 -8 Left 1049966993 9:788876-788898 CCAGGGCACAGGGTCTAATGAGG No data
Right 1049966999 9:788891-788913 TAATGAGGGAAGGCTGGTGTGGG No data
1049966993_1049967003 24 Left 1049966993 9:788876-788898 CCAGGGCACAGGGTCTAATGAGG No data
Right 1049967003 9:788923-788945 TGCACCACACTGAGTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049966993 Original CRISPR CCTCATTAGACCCTGTGCCC TGG (reversed) Intergenic
No off target data available for this crispr