ID: 1049968767

View in Genome Browser
Species Human (GRCh38)
Location 9:802712-802734
Sequence GTGTGAGTGAGCCGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049968756_1049968767 28 Left 1049968756 9:802661-802683 CCATCAGACGGCTTGGCCACTGC No data
Right 1049968767 9:802712-802734 GTGTGAGTGAGCCGGGAGGCTGG No data
1049968755_1049968767 29 Left 1049968755 9:802660-802682 CCCATCAGACGGCTTGGCCACTG No data
Right 1049968767 9:802712-802734 GTGTGAGTGAGCCGGGAGGCTGG No data
1049968758_1049968767 4 Left 1049968758 9:802685-802707 CCTTCAGAAAATGCTTTCCTCCC No data
Right 1049968767 9:802712-802734 GTGTGAGTGAGCCGGGAGGCTGG No data
1049968757_1049968767 12 Left 1049968757 9:802677-802699 CCACTGCTCCTTCAGAAAATGCT No data
Right 1049968767 9:802712-802734 GTGTGAGTGAGCCGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049968767 Original CRISPR GTGTGAGTGAGCCGGGAGGC TGG Intergenic