ID: 1049981467

View in Genome Browser
Species Human (GRCh38)
Location 9:907970-907992
Sequence TCAGTACCACTGATGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049981464_1049981467 19 Left 1049981464 9:907928-907950 CCTTTTGGAAAACATGGTCTCAA 0: 1
1: 0
2: 4
3: 27
4: 265
Right 1049981467 9:907970-907992 TCAGTACCACTGATGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049981467 Original CRISPR TCAGTACCACTGATGGCAGA TGG Intronic
No off target data available for this crispr